ID: 1190993863

View in Genome Browser
Species Human (GRCh38)
Location X:55585068-55585090
Sequence GGTTTCGATAATGAATTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190993863_1190993872 20 Left 1190993863 X:55585068-55585090 CCCCAAAATTCATTATCGAAACC No data
Right 1190993872 X:55585111-55585133 TTGGAGGTGGAGCCTTTGTGAGG No data
1190993863_1190993871 7 Left 1190993863 X:55585068-55585090 CCCCAAAATTCATTATCGAAACC No data
Right 1190993871 X:55585098-55585120 CATGTGAAGATATTTGGAGGTGG No data
1190993863_1190993873 28 Left 1190993863 X:55585068-55585090 CCCCAAAATTCATTATCGAAACC No data
Right 1190993873 X:55585119-55585141 GGAGCCTTTGTGAGGTGATTAGG No data
1190993863_1190993867 1 Left 1190993863 X:55585068-55585090 CCCCAAAATTCATTATCGAAACC No data
Right 1190993867 X:55585092-55585114 AATTCCCATGTGAAGATATTTGG No data
1190993863_1190993868 4 Left 1190993863 X:55585068-55585090 CCCCAAAATTCATTATCGAAACC No data
Right 1190993868 X:55585095-55585117 TCCCATGTGAAGATATTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190993863 Original CRISPR GGTTTCGATAATGAATTTTG GGG (reversed) Intergenic
No off target data available for this crispr