ID: 1190993867

View in Genome Browser
Species Human (GRCh38)
Location X:55585092-55585114
Sequence AATTCCCATGTGAAGATATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190993863_1190993867 1 Left 1190993863 X:55585068-55585090 CCCCAAAATTCATTATCGAAACC No data
Right 1190993867 X:55585092-55585114 AATTCCCATGTGAAGATATTTGG No data
1190993865_1190993867 -1 Left 1190993865 X:55585070-55585092 CCAAAATTCATTATCGAAACCTA No data
Right 1190993867 X:55585092-55585114 AATTCCCATGTGAAGATATTTGG No data
1190993860_1190993867 28 Left 1190993860 X:55585041-55585063 CCTGCTATGGACTGAATGTTTGT 0: 14
1: 85
2: 429
3: 823
4: 1037
Right 1190993867 X:55585092-55585114 AATTCCCATGTGAAGATATTTGG No data
1190993861_1190993867 3 Left 1190993861 X:55585066-55585088 CCCCCCAAAATTCATTATCGAAA No data
Right 1190993867 X:55585092-55585114 AATTCCCATGTGAAGATATTTGG No data
1190993864_1190993867 0 Left 1190993864 X:55585069-55585091 CCCAAAATTCATTATCGAAACCT No data
Right 1190993867 X:55585092-55585114 AATTCCCATGTGAAGATATTTGG No data
1190993862_1190993867 2 Left 1190993862 X:55585067-55585089 CCCCCAAAATTCATTATCGAAAC No data
Right 1190993867 X:55585092-55585114 AATTCCCATGTGAAGATATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190993867 Original CRISPR AATTCCCATGTGAAGATATT TGG Intergenic
No off target data available for this crispr