ID: 1190993871

View in Genome Browser
Species Human (GRCh38)
Location X:55585098-55585120
Sequence CATGTGAAGATATTTGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190993862_1190993871 8 Left 1190993862 X:55585067-55585089 CCCCCAAAATTCATTATCGAAAC No data
Right 1190993871 X:55585098-55585120 CATGTGAAGATATTTGGAGGTGG No data
1190993865_1190993871 5 Left 1190993865 X:55585070-55585092 CCAAAATTCATTATCGAAACCTA No data
Right 1190993871 X:55585098-55585120 CATGTGAAGATATTTGGAGGTGG No data
1190993864_1190993871 6 Left 1190993864 X:55585069-55585091 CCCAAAATTCATTATCGAAACCT No data
Right 1190993871 X:55585098-55585120 CATGTGAAGATATTTGGAGGTGG No data
1190993863_1190993871 7 Left 1190993863 X:55585068-55585090 CCCCAAAATTCATTATCGAAACC No data
Right 1190993871 X:55585098-55585120 CATGTGAAGATATTTGGAGGTGG No data
1190993861_1190993871 9 Left 1190993861 X:55585066-55585088 CCCCCCAAAATTCATTATCGAAA No data
Right 1190993871 X:55585098-55585120 CATGTGAAGATATTTGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190993871 Original CRISPR CATGTGAAGATATTTGGAGG TGG Intergenic
No off target data available for this crispr