ID: 1190993872

View in Genome Browser
Species Human (GRCh38)
Location X:55585111-55585133
Sequence TTGGAGGTGGAGCCTTTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190993870_1190993872 -9 Left 1190993870 X:55585097-55585119 CCATGTGAAGATATTTGGAGGTG No data
Right 1190993872 X:55585111-55585133 TTGGAGGTGGAGCCTTTGTGAGG No data
1190993869_1190993872 -8 Left 1190993869 X:55585096-55585118 CCCATGTGAAGATATTTGGAGGT No data
Right 1190993872 X:55585111-55585133 TTGGAGGTGGAGCCTTTGTGAGG No data
1190993865_1190993872 18 Left 1190993865 X:55585070-55585092 CCAAAATTCATTATCGAAACCTA No data
Right 1190993872 X:55585111-55585133 TTGGAGGTGGAGCCTTTGTGAGG No data
1190993864_1190993872 19 Left 1190993864 X:55585069-55585091 CCCAAAATTCATTATCGAAACCT No data
Right 1190993872 X:55585111-55585133 TTGGAGGTGGAGCCTTTGTGAGG No data
1190993866_1190993872 -1 Left 1190993866 X:55585089-55585111 CCTAATTCCCATGTGAAGATATT No data
Right 1190993872 X:55585111-55585133 TTGGAGGTGGAGCCTTTGTGAGG No data
1190993861_1190993872 22 Left 1190993861 X:55585066-55585088 CCCCCCAAAATTCATTATCGAAA No data
Right 1190993872 X:55585111-55585133 TTGGAGGTGGAGCCTTTGTGAGG No data
1190993863_1190993872 20 Left 1190993863 X:55585068-55585090 CCCCAAAATTCATTATCGAAACC No data
Right 1190993872 X:55585111-55585133 TTGGAGGTGGAGCCTTTGTGAGG No data
1190993862_1190993872 21 Left 1190993862 X:55585067-55585089 CCCCCAAAATTCATTATCGAAAC No data
Right 1190993872 X:55585111-55585133 TTGGAGGTGGAGCCTTTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190993872 Original CRISPR TTGGAGGTGGAGCCTTTGTG AGG Intergenic
No off target data available for this crispr