ID: 1190996745

View in Genome Browser
Species Human (GRCh38)
Location X:55617465-55617487
Sequence GACCTGTTACTGGGCTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 620
Summary {0: 7, 1: 150, 2: 161, 3: 101, 4: 201}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190996745_1190996750 7 Left 1190996745 X:55617465-55617487 CCACCAAAGCCCAGTAACAGGTC 0: 7
1: 150
2: 161
3: 101
4: 201
Right 1190996750 X:55617495-55617517 GAGTAGTTATCTACAGAAGATGG No data
1190996745_1190996751 11 Left 1190996745 X:55617465-55617487 CCACCAAAGCCCAGTAACAGGTC 0: 7
1: 150
2: 161
3: 101
4: 201
Right 1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG No data
1190996745_1190996752 12 Left 1190996745 X:55617465-55617487 CCACCAAAGCCCAGTAACAGGTC 0: 7
1: 150
2: 161
3: 101
4: 201
Right 1190996752 X:55617500-55617522 GTTATCTACAGAAGATGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190996745 Original CRISPR GACCTGTTACTGGGCTTTGG TGG (reversed) Intergenic
900168573 1:1255032-1255054 AATGTGTGACTGGGCTTTGGAGG - Intronic
900434964 1:2625622-2625644 GGCCCGTTACTGGGCTTTGGTGG + Intronic
901904045 1:12392638-12392660 GGCCTGTTACTGGGCTTTGGTGG - Intronic
902632029 1:17710659-17710681 GCCATGTGACTGGTCTTTGGAGG + Intergenic
904041853 1:27589999-27590021 GACATGTGACTGGGCCTTAGAGG + Intronic
904823848 1:33262076-33262098 GGGCTGGAACTGGGCTTTGGAGG + Intronic
905354071 1:37368829-37368851 GGCCTGTTACTTGGCTTTGGTGG + Intergenic
905465230 1:38148145-38148167 AGCCTGTTACTGGGCTTTGGTGG + Intergenic
906050494 1:42867460-42867482 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
906739178 1:48164661-48164683 GACCGGTTACAGGGTTTTGAAGG + Intergenic
906879680 1:49576509-49576531 GGCTTGTTACTGGGCTTTGGTGG + Intronic
906944184 1:50281605-50281627 TTCCTATTTCTGGGCTTTGGGGG - Intergenic
907656151 1:56343374-56343396 CATCTGCTCCTGGGCTTTGGTGG - Intergenic
907780347 1:57560880-57560902 GGCCTGTTACTGGGCTTTGGTGG + Intronic
908052316 1:60246759-60246781 GGCCTGTTGCTGGGCTTTGGTGG + Intergenic
909548943 1:76877137-76877159 TTGCTGTTACTGGGCTTTGGTGG - Intronic
909576926 1:77185904-77185926 GGCCTGTTACTGGGCTTTGGTGG + Intronic
909810959 1:79931383-79931405 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
910086809 1:83412805-83412827 CACCTGTTCCTGGGGTTTGAAGG - Intergenic
910370640 1:86512174-86512196 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
910559944 1:88579362-88579384 GACATGCTACTGGGCCCTGGTGG + Intergenic
910588220 1:88901772-88901794 GTCTTGTTACTGGGCTTTAGTGG + Intergenic
910630227 1:89346298-89346320 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
910638986 1:89439928-89439950 GGCCTGTTACTGGACTTTGGTGG - Intergenic
910790327 1:91043766-91043788 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
910831092 1:91463378-91463400 GGCCTGTTATTGGGCTTTGGTGG - Intergenic
910833789 1:91486909-91486931 TAAATGTTGCTGGGCTTTGGGGG + Intergenic
910948219 1:92616734-92616756 GGCCTGTTACTGGACTTTGGTGG + Intronic
911109092 1:94164159-94164181 GGCCTGTTACTGGGCTTTGGTGG - Intronic
911257319 1:95647318-95647340 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
911738392 1:101361873-101361895 GGCCTGTTACTGGGCTTCGGTGG - Intergenic
911980431 1:104559467-104559489 GGCCTGTTACTAGGCTTTGGTGG + Intergenic
911981894 1:104579216-104579238 GGCCTGTTATTGGGCTTTGGTGG - Intergenic
912212258 1:107568940-107568962 GGATTGCTACTGGGCTTTGGTGG + Intergenic
912252023 1:108021342-108021364 GGGTTGTTACTGGGCTTTGGTGG - Intergenic
912733317 1:112128783-112128805 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
912943807 1:114068158-114068180 AGCCTGTTACTGGGCTTTGGTGG - Intergenic
913039441 1:115008349-115008371 GTCCTGTTACTGGGATTTGGTGG - Intergenic
916106324 1:161435281-161435303 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
916285322 1:163099574-163099596 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
916369830 1:164079842-164079864 GGCCTGTTACTGGCCCTTAGTGG + Intergenic
917217208 1:172690867-172690889 GGTCTGTTACTGGGCTTTGGTGG - Intergenic
917462713 1:175246229-175246251 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
917992233 1:180393003-180393025 TACCTTTTAATGTGCTTTGGGGG + Intronic
918755708 1:188337763-188337785 GGCCCGTTACTGGGTTTTGGTGG - Intergenic
918774498 1:188610793-188610815 TGCCTGTTACTGGGCTTTGGTGG + Intergenic
918815084 1:189171274-189171296 GGTCTGTTACTGGGCTTTGGTGG + Intergenic
918918225 1:190671833-190671855 GGCCTGTTAATGGGGTTTGGTGG - Intergenic
918958250 1:191237995-191238017 GGCCTGTTACTGGCCTTTGGTGG + Intergenic
919990805 1:202707884-202707906 GACCTGGGGGTGGGCTTTGGAGG - Intronic
920197437 1:204238412-204238434 GGTCTGTTACTGGGCTTTGGTGG + Intronic
922781045 1:228252535-228252557 GGCCTGTTACTGAGCTTTGGTGG - Intronic
923253564 1:232199391-232199413 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
924840771 1:247707786-247707808 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1064517637 10:16168210-16168232 GCCACGTTACCGGGCTTTGGTGG - Intergenic
1065005331 10:21374210-21374232 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
1066160317 10:32721233-32721255 GGCCTGTTATTGGACATTGGTGG - Intronic
1066312432 10:34210973-34210995 GACATGTTTATGGGCTTAGGAGG + Intronic
1066821662 10:39500257-39500279 GAGCTGTTTGAGGGCTTTGGTGG + Intergenic
1067125548 10:43512498-43512520 GGCCTATTACTGGGCTCTGGTGG - Intergenic
1067271097 10:44791895-44791917 GAGCTGATACTGGGCTTCTGGGG - Intergenic
1067333142 10:45340263-45340285 GGCCTGTTACTGAGCTTTGGTGG + Intergenic
1068007668 10:51409524-51409546 GGCCTGTCACTGGGCTTTGGTGG - Intronic
1068447215 10:57138639-57138661 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
1068837211 10:61568332-61568354 GGCCTGTTACTGGGCTGTGGTGG - Intergenic
1069790824 10:71019537-71019559 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1071267079 10:83973956-83973978 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1071378386 10:85033403-85033425 GGCCTGTTACTGCACTTTGTTGG + Intergenic
1071673922 10:87637383-87637405 GGCCTGTTACTGGGCCTTGGTGG - Intergenic
1071937693 10:90549322-90549344 GGCCTGTTCCTGGGCTTTGGTGG + Intergenic
1071942777 10:90607732-90607754 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1072209255 10:93231632-93231654 GGCTTGTTACTGGACTTTGATGG - Intergenic
1072360473 10:94654189-94654211 GGACTGTTACTCGGCTTTGGTGG + Intergenic
1073557354 10:104465946-104465968 GGTCTGTTACTGGGCTTTGGTGG + Intergenic
1073656676 10:105424438-105424460 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1073830501 10:107377963-107377985 GGCCTATTACTGGGCCTTAGTGG - Intergenic
1073918471 10:108432269-108432291 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1073995868 10:109314671-109314693 GGCTTATTACTGGGCTTTGGTGG - Intergenic
1075249720 10:120855919-120855941 GTCCTGTTCCTGAGCTTAGGGGG + Intronic
1075311954 10:121421815-121421837 GACCCATTCCTGGGCTGTGGAGG - Intergenic
1076772624 10:132674793-132674815 GGCCTGTTACTGGGCTTTGGTGG - Intronic
1076927411 10:133499180-133499202 AGCCTGTTACTGGGCTTTGGTGG - Intergenic
1080020136 11:27551620-27551642 GGCCTGCTACTGGGCTTTAGTGG - Intergenic
1080076598 11:28157541-28157563 GGCCTGTTACTGGGCATTGGTGG + Intronic
1080976684 11:37350618-37350640 GGCTTGTTACTGGGCTTTCATGG + Intergenic
1081065456 11:38534856-38534878 GGCTTGTTATTGGGCTTCGGTGG - Intergenic
1081072781 11:38631141-38631163 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
1081609065 11:44547898-44547920 GGCCTGTTACTGGGCTTTGATGG + Intergenic
1082671704 11:56043062-56043084 TGCCTGCTACTGGGCTTTGGTGG + Intergenic
1082882061 11:58047494-58047516 AACCTCTTCTTGGGCTTTGGTGG + Intronic
1083777561 11:64901762-64901784 GCCCTGATGCTGGGCTTTGATGG - Intronic
1083968754 11:66059417-66059439 GAACTCTTACAGAGCTTTGGTGG + Intronic
1085684624 11:78610437-78610459 GGCCTGATACTGGGCCTTAGAGG + Intergenic
1085685966 11:78622210-78622232 GGCCTGTTACTGGGATTTGTTGG + Intergenic
1085747575 11:79128260-79128282 GGCCTGTTACTGGGCTTTGGTGG + Intronic
1085876037 11:80406668-80406690 CATCTGTTTCTGGGCTTTGGTGG - Intergenic
1086278616 11:85160472-85160494 GGCCTGTTATTGGGCTTTAGTGG + Intronic
1086834120 11:91600413-91600435 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
1087374026 11:97320574-97320596 GGCCTGTTGCTAGGCTTTGGTGG + Intergenic
1088191656 11:107234470-107234492 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1088265421 11:107983631-107983653 GGCCTGCTGCTGAGCTTTGGTGG + Intergenic
1088407608 11:109498642-109498664 GGCCTGTTACTGGGTCTTGTTGG - Intergenic
1088449358 11:109965388-109965410 GGCCTGTTACCAGGCTTTGGTGG + Intergenic
1088836660 11:113583409-113583431 GGCCTGTCACTGGGCTTTGGTGG + Intergenic
1089903610 11:122013629-122013651 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
1090209488 11:124908030-124908052 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1091051742 11:132378776-132378798 GGCCTGTTACTGAGCTTTGGTGG + Intergenic
1092056550 12:5512439-5512461 ATCTTGTTACTGGGGTTTGGGGG + Intronic
1092093286 12:5821671-5821693 GGCCTGTTACAGGACTTTGATGG + Intronic
1092381564 12:8000959-8000981 GGTCTGTTACTGAGCTTTGGCGG + Intergenic
1092518664 12:9242630-9242652 GACCTGGATCTGGGATTTGGTGG - Intergenic
1093031866 12:14295929-14295951 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1093036341 12:14335704-14335726 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
1093392081 12:18635514-18635536 GACCTGCTACTAGGCCTTAGTGG - Intronic
1093645733 12:21583691-21583713 GGCCTGTTACTGGGCTTTGGTGG + Intronic
1093713685 12:22356413-22356435 GCCCTTTTACTGGGCTTTAGTGG - Intronic
1094102535 12:26779283-26779305 GGTCTGGTACTGGGCTTTGGTGG + Intronic
1095121502 12:38424823-38424845 GGCCTGTGACAGGGCTTTGGTGG - Intergenic
1095520920 12:43064772-43064794 GACCTGGTACCGGCCTTTGAAGG - Intergenic
1095603858 12:44044355-44044377 GGCCTGTTTCTGGGCTTTGGTGG + Intronic
1095844391 12:46729947-46729969 GGCCTGTTAATGGGCTAAGGTGG - Intergenic
1096288716 12:50322981-50323003 GGCCTGCTACTGGGCTTTGGTGG + Intergenic
1096453210 12:51762990-51763012 GACCTCACACTGGGCCTTGGGGG - Intronic
1096457462 12:51799416-51799438 GGCCTGTTACTGGGCTTTGGTGG - Intronic
1097077003 12:56402462-56402484 GACCTGTTACTGGGCTTTGATGG + Intergenic
1097437834 12:59572233-59572255 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1097821337 12:64131843-64131865 GGCCTGTTACTGGGCTTTGGTGG - Intronic
1097843353 12:64342740-64342762 GGCCTGTTACTGGGCTTTGGTGG - Intronic
1098716094 12:73829836-73829858 GGCCCGTTACTGGGCTTTGGTGG + Intergenic
1098749847 12:74279612-74279634 AGCCTGTTACTGAGCTTTTGTGG + Intergenic
1099183376 12:79492567-79492589 GGCCTATTACCGAGCTTTGGTGG - Intergenic
1099365928 12:81765405-81765427 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
1099375651 12:81893978-81894000 GGCCTGTTACTAGGCTTTGGTGG + Intergenic
1099379378 12:81936519-81936541 GGCCTGTTACTGGGTTTTGGTGG - Intergenic
1099526365 12:83723132-83723154 GGCCTGTTACCAGACTTTGGTGG + Intergenic
1099578079 12:84405412-84405434 GGCCTGTTACTGGGCTTTTGTGG + Intergenic
1099689784 12:85938058-85938080 TGTCTGTTACTGGGCTTTGGTGG + Intergenic
1100241148 12:92711587-92711609 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1101264135 12:103066143-103066165 GGCCAATTACTGGGATTTGGTGG + Intergenic
1101534664 12:105606083-105606105 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1101543075 12:105682657-105682679 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
1103035614 12:117654084-117654106 GGCCTGTTACTAAGCTTTGGTGG + Intronic
1105208000 13:18239176-18239198 GACCTGTTGCTGTGCTGGGGAGG - Intergenic
1105332719 13:19432996-19433018 AACCTGCTACTGAGGTTTGGAGG - Intronic
1105740113 13:23315197-23315219 GGCCTGTTACTGGGCTTTGGTGG + Intronic
1106741968 13:32653930-32653952 GACCTATTTCAGGGCTTTGGGGG + Intronic
1107165248 13:37276095-37276117 GACCAGCTACTGGGCTGTTGTGG + Intergenic
1107983572 13:45755951-45755973 GGCCTATTACTGGGCTTTGGTGG - Intergenic
1108302430 13:49091964-49091986 GGCCCGTTACTGGGCTTTGGTGG - Intronic
1108904280 13:55449992-55450014 GGCCTGTTACTGAGCTTTGGTGG + Intergenic
1109293228 13:60500139-60500161 GGCCTGTTACTGGGTTTTGGTGG + Intronic
1109519026 13:63484822-63484844 GGCTTGTTACTGGGCTTTGGTGG + Intergenic
1109583052 13:64366188-64366210 GGCCTGTTACTGGGCTTCGGTGG + Intergenic
1109705070 13:66079244-66079266 GACCTGCTACTGGGATTTAGTGG + Intergenic
1110377175 13:74806490-74806512 GGCCTGTTACTGGGCTTTGTTGG + Intergenic
1110834131 13:80064608-80064630 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1111057796 13:82973006-82973028 GGCCTGTTACTGGGCTTTCGTGG - Intergenic
1112231124 13:97590143-97590165 GGTTTGTTACTGGTCTTTGGTGG - Intergenic
1112249924 13:97770257-97770279 GGGCTGTTACTGGGCTTTCGTGG - Intergenic
1112989690 13:105497074-105497096 TACCTGAGACTGGGCTCTGGAGG + Intergenic
1113319702 13:109221642-109221664 GACCTATTACTGGGCTTTAGTGG - Intergenic
1113574132 13:111382411-111382433 GGCCTGTTCCAGGGCTGTGGTGG + Intergenic
1113677343 13:112215747-112215769 GACCTGTTAATGGGTTCTGGTGG - Intergenic
1113760791 13:112845057-112845079 GTCCAGTTACTGGGCACTGGTGG + Intronic
1114205874 14:20570790-20570812 GGCCTGTTACTGGGCTTTGGAGG + Intergenic
1114758254 14:25283855-25283877 CACCTGTTACTGGGCTTTGGTGG - Intergenic
1115059720 14:29173915-29173937 GGCTTGTAACTGGGCTTTGGTGG + Intergenic
1116158374 14:41236644-41236666 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1116415075 14:44669331-44669353 GGCCTGTTGCTGGGCTTTGCTGG + Intergenic
1117216847 14:53560196-53560218 GGCCTGTTACTGGGCTTTGTTGG + Intergenic
1117596271 14:57329862-57329884 GGCCTGTTATTGAGCTTTGGTGG - Intergenic
1117634137 14:57724394-57724416 GGCCTGTTACTGGGTTTTGGTGG + Intronic
1118122430 14:62860149-62860171 AGCCTGTTACTGGGCTTTGGTGG - Intronic
1118415108 14:65527590-65527612 GTTCTGTTGCTGGCCTTTGGAGG + Intronic
1118880770 14:69823997-69824019 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1119059694 14:71462169-71462191 TGTCTGTTACTGGGCTTTGCTGG - Intronic
1119107560 14:71938818-71938840 GGCCTATTACTGGGCTTTGGTGG - Intronic
1120082021 14:80227509-80227531 TGCCTGTTCCTGGGCCTTGGTGG - Intronic
1120555988 14:85930417-85930439 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1120973706 14:90230847-90230869 GGCCTGTTACTGGGCTTTGCTGG + Intergenic
1123908495 15:24943633-24943655 GGCCTGCTACTGGGCATTAGTGG - Intronic
1124411822 15:29443329-29443351 GAGAGGTTCCTGGGCTTTGGAGG - Intronic
1126283614 15:46986298-46986320 GGCCTGTTATTGGGCTCTGGTGG + Intergenic
1127329419 15:57923997-57924019 CACCCGCTACTGGGCTTGGGTGG - Intergenic
1128851354 15:70960205-70960227 CCAGTGTTACTGGGCTTTGGAGG + Intronic
1129327721 15:74810143-74810165 GAAATTTTACTGTGCTTTGGAGG - Intergenic
1135487552 16:22879376-22879398 GAACTGTTACTGGGCTCTCCAGG + Intronic
1138868388 16:60850803-60850825 TTCCTGTTATTGGGCTTTGGTGG + Intergenic
1139345041 16:66297329-66297351 TACCTGTTACTTGGCTTCAGGGG - Intergenic
1140902524 16:79382666-79382688 GACATGTTACTAGTGTTTGGAGG - Intergenic
1141559539 16:84858017-84858039 GGCCTGTTACTGGGCTTTGGTGG - Intronic
1141757747 16:86003735-86003757 GTGTTGTTTCTGGGCTTTGGTGG + Intergenic
1141962956 16:87421559-87421581 GACCTGGTGCTGGGCTTGTGGGG - Intronic
1143504748 17:7357376-7357398 GACGTGCTACTGGCCTCTGGTGG + Intergenic
1145085184 17:19931732-19931754 GATCTGTTACTGGGATGTGAAGG + Intronic
1145304078 17:21662260-21662282 TACCTGTTGATGGGGTTTGGGGG + Intergenic
1146237987 17:31185969-31185991 GACCTGTTACTGGGCTTTGGTGG + Intronic
1146836359 17:36114021-36114043 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
1146850937 17:36221061-36221083 AGCCTGTTACTGGGCTTTGGTGG + Intronic
1148887032 17:50781338-50781360 GCCCTGCTACTGCGCCTTGGCGG - Intergenic
1151899414 17:77001970-77001992 TAACTGATACTGGGTTTTGGAGG - Intergenic
1203163030 17_GL000205v2_random:69145-69167 GACCTGCTACTGGGCTTTACAGG + Intergenic
1153089713 18:1330179-1330201 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
1154252668 18:12757258-12757280 GGCCTGTTACTAGGCTTTGGTGG - Intergenic
1154506176 18:15042907-15042929 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
1155940711 18:31799615-31799637 GGTCTGTTACTGGGCTTTGGTGG + Intergenic
1156303864 18:35858711-35858733 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
1156561223 18:38128017-38128039 GACCTTTAACTGGGCCTGGGTGG + Intergenic
1156582554 18:38394481-38394503 AGCCTATTACTGGGCTTTGGTGG + Intergenic
1156606375 18:38671782-38671804 GGCCTGTGATTGGGCTTTGGTGG + Intergenic
1156990299 18:43400758-43400780 GGGCTATTACTGGGCGTTGGTGG - Intergenic
1156998582 18:43497746-43497768 GGCCTCTTACTGGGCTTTAGTGG + Intergenic
1157341206 18:46780044-46780066 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
1157566008 18:48679837-48679859 GACCTGGAACTGGGCCTTGGGGG + Intronic
1157757909 18:50234970-50234992 GACCTGTTATTGGGCCTTGATGG - Intronic
1157870928 18:51229564-51229586 GGTCTGCTACTGGGCCTTGGTGG - Intergenic
1157998502 18:52588107-52588129 GGCCTGTTACTGGACTTTGGTGG - Intronic
1158201601 18:54947788-54947810 AATCTGTTACTGGGCTATGAAGG + Intronic
1158938947 18:62389329-62389351 GACCTGACACTGGGCAGTGGCGG + Exonic
1159287792 18:66375499-66375521 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
1159559101 18:69975334-69975356 GGCTTGTTACTGGGCTTTGGTGG - Intergenic
1159651393 18:70983182-70983204 GACTTGCTACTGAGCATTGGTGG + Intergenic
1160092467 18:75840032-75840054 GGCCTGTTACTGGGCTCTGGTGG + Intergenic
1162437185 19:10668284-10668306 GTCCTGTTGCTGGGCTTTGCAGG + Intronic
1162501830 19:11058502-11058524 GACCTGGTCGTGGGCTTTTGGGG + Intronic
1165155848 19:33787069-33787091 GACTTACCACTGGGCTTTGGGGG + Intergenic
1165460286 19:35940146-35940168 GCCCTGGTGCTGGCCTTTGGCGG + Exonic
1168187371 19:54708751-54708773 GTCTTGTTCCTGGGCTCTGGTGG - Intergenic
925279956 2:2676885-2676907 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
925460730 2:4060463-4060485 TGTCTATTACTGGGCTTTGGTGG + Intergenic
925499405 2:4486907-4486929 GACTTGTTACTGGGCTCCGCTGG - Intergenic
926471743 2:13268749-13268771 GACCAAAAACTGGGCTTTGGAGG + Intergenic
926810392 2:16750659-16750681 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
926825564 2:16902213-16902235 GGCTTGTTACTGAGCTTTGGTGG - Intergenic
926826766 2:16913685-16913707 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
927008721 2:18879741-18879763 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
927660435 2:24988686-24988708 GGCCTGTTACTGGTCTTTGGTGG + Intergenic
927861686 2:26563881-26563903 GACCTCTCTCTGGGCCTTGGAGG + Intronic
929246153 2:39705882-39705904 GACCTGTTACCTGGCCTTGGGGG + Intronic
930295400 2:49547492-49547514 GGCCGGTTACTGGGCTTTGATGG - Intergenic
930536607 2:52652245-52652267 GGCCTGTTACTAAGCTTTGGTGG - Intergenic
930910154 2:56620916-56620938 CACCTGGTAATGGGATTTGGTGG + Intergenic
932700210 2:73986323-73986345 GACCTGTTGGTGGCCTTTGGAGG + Intergenic
932870702 2:75395064-75395086 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
933671043 2:85007522-85007544 GACCTGTTCCTGGGAGCTGGAGG - Intronic
935183939 2:100714918-100714940 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
935425106 2:102911308-102911330 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
937582061 2:123499148-123499170 GGCCCATTACTAGGCTTTGGTGG - Intergenic
937852566 2:126648719-126648741 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
938419310 2:131131431-131131453 GTCCTGTTTCTGGCCTTAGGAGG + Intronic
939069066 2:137517875-137517897 GGCCTGTTACTGGGCTTTGGTGG + Intronic
939213876 2:139212259-139212281 GGCCTGTTATTGGGCTTTGGTGG + Intergenic
939918386 2:148077304-148077326 GTCTTGTTACTGGGCATTGTAGG + Intronic
940171310 2:150832693-150832715 GGCCTGTTACTAGGCTTTGGTGG - Intergenic
940178215 2:150902913-150902935 CACCTGTTATTTGGATTTGGGGG - Intergenic
940472086 2:154113108-154113130 GACCTGTTACTGGGCTTTGGTGG - Intronic
940605912 2:155924269-155924291 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
941668020 2:168261147-168261169 TGCCTGTTACTGGGCTTTGGTGG + Intergenic
942848778 2:180457848-180457870 GATGTGTTACTGGGCCTTAGCGG + Intergenic
943239215 2:185362553-185362575 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
943317925 2:186412300-186412322 GGTCTGTTACTGGGCTTTGGTGG - Intergenic
943384060 2:187181071-187181093 TACCTGTTACTGGGCTTTGGTGG - Intergenic
943388132 2:187227155-187227177 GGCCTGTTACTGGGCTTTAGCGG + Intergenic
943517594 2:188907223-188907245 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
945642182 2:212443856-212443878 GGACTATTACTGGGCTTTGGTGG + Intronic
945725841 2:213471476-213471498 GGTCTGTTACTGGGCTTTGGTGG - Intronic
946527864 2:220539948-220539970 GGCCCGTTACTGGGCTTTGGTGG - Intergenic
946703771 2:222437773-222437795 GGCCTGTTACTAGGCTTTGGTGG - Intronic
947440710 2:230118647-230118669 GGCCTATTACTGGGCTTTGGTGG - Intergenic
947440850 2:230120276-230120298 GGCCTATTACTGGTCTTTGGTGG + Intergenic
1168736803 20:147260-147282 GCCCTGTGACAGTGCTTTGGAGG - Intergenic
1170112657 20:12822430-12822452 GGCCTGTTGCTGGGCGGTGGAGG - Intergenic
1171521636 20:25780078-25780100 TACCTGTTGATGGGGTTTGGGGG + Intronic
1171555205 20:26075973-26075995 TACCTGTTGATGGGGTTTGGGGG - Intergenic
1172886753 20:38236462-38236484 GACCAAGGACTGGGCTTTGGGGG + Intronic
1173504976 20:43579694-43579716 GACCCTTTGCTAGGCTTTGGGGG - Intronic
1173703046 20:45090154-45090176 GGCTTGCTACTGGGCTTTGATGG + Intergenic
1175067307 20:56300334-56300356 GGCCTGTTCCTGATCTTTGGGGG - Intergenic
1176096820 20:63348138-63348160 GACCTGGTTCTGGGCTTGTGGGG - Intronic
1176655439 21:9585002-9585024 TACCTGTTGATGGGGTTTGGGGG + Intergenic
1176740305 21:10595546-10595568 AACCTGCTACTGAGGTTTGGAGG + Intronic
1176791677 21:13326117-13326139 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1176998164 21:15580203-15580225 GGCCTGTTACTGGGCTTCGGTGG + Intergenic
1177139412 21:17342250-17342272 GGCCTGTTACTGGGTTTTGGTGG - Intergenic
1177505557 21:22014163-22014185 GGCCTGCTACTGGGCTTTGGTGG - Intergenic
1177913179 21:27056229-27056251 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
1177933694 21:27316913-27316935 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1177991068 21:28037119-28037141 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1178012663 21:28305194-28305216 GGCCTGCTACTGGACTTTGGTGG + Intergenic
1179415146 21:41192502-41192524 GGCCTGTTACTGGGCTTTGGTGG - Intronic
1179534899 21:42045171-42045193 GACCTGTTTTAGGGCTTGGGGGG + Intergenic
1180591144 22:16938348-16938370 GGCCTGTTACTGGGCTTTGATGG - Intergenic
1180758566 22:18181065-18181087 GACCTGTTGCTGTGCTGGGGAGG - Intergenic
1180768853 22:18364857-18364879 GACCTGTTGCTGTGCTGGGGAGG - Intergenic
1180777459 22:18497538-18497560 GACCTGTTGCTGTGCTGGGGAGG + Intergenic
1180810179 22:18754848-18754870 GACCTGTTGCTGTGCTGGGGAGG + Intergenic
1180826728 22:18868081-18868103 GACCTGTTGCTGTGCTGGGGAGG - Intergenic
1181196323 22:21189100-21189122 GACCTGTTGCTGTGCTGGGGAGG + Intergenic
1181213204 22:21304024-21304046 GACCTGTTGCTGTGCTGGGGAGG - Intergenic
1181367433 22:22388925-22388947 GGCCTATTACTGGGCTTTGGTGG - Intergenic
1181420657 22:22795850-22795872 GGCCTGTTACTGGGCTTTGGTGG + Intronic
1181529688 22:23510233-23510255 GACCTGTAAATGGGCGGTGGGGG + Intergenic
1183604121 22:38858816-38858838 GACCTGTTAGCTGGCTTGGGGGG + Intergenic
1184172904 22:42769880-42769902 GGCCTGCTCCTGGGCTGTGGGGG - Intergenic
1184603557 22:45558356-45558378 GGCCTGTTACTGGGCTTTGGTGG - Intronic
1184778941 22:46636595-46636617 CACCTGTTACCTGGCTCTGGAGG + Intronic
1203230475 22_KI270731v1_random:105741-105763 GACCTGTTGCTGTGCTGGGGAGG - Intergenic
1203276869 22_KI270734v1_random:93991-94013 GACCTGTTGCTGTGCTGGGGAGG - Intergenic
949125661 3:443127-443149 TGCCTGTTACTGGGCTTTGGTGG - Intergenic
949245872 3:1924941-1924963 GGTCTGTTACTGGGCTTTGGTGG + Intergenic
949417589 3:3830864-3830886 GGCCTGTTACTAGGCTTTGGTGG - Intronic
949445614 3:4131072-4131094 GGCCTGTTACTGGGCTTTGATGG + Intronic
949638783 3:6012535-6012557 AGCCTGTTACTGGGCTTTGGTGG + Intergenic
950724290 3:14906444-14906466 GACCTTTGCCTGGGCTGTGGGGG + Intronic
951003621 3:17592870-17592892 GGCCTGTTACTAGGCTTTTGTGG + Intronic
951122575 3:18945585-18945607 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
951291515 3:20876727-20876749 GGCCTATTATTGGGCTTTGGTGG - Intergenic
951384529 3:22027553-22027575 GGCCTGTTACTGGGCTTTGGTGG + Intronic
951970759 3:28441847-28441869 GGTCTGTTACTGGGCTTTGGTGG - Intronic
952605439 3:35141997-35142019 GGCTTGTTACTGGGTTTTGGTGG - Intergenic
953011248 3:39027350-39027372 GGATTGTTACTGGGTTTTGGGGG + Intergenic
953937008 3:47054073-47054095 CAGATGATACTGGGCTTTGGGGG - Intronic
954054159 3:48007978-48008000 GGCCTGTTACTGGGCTTTAGTGG + Intronic
954511487 3:51129643-51129665 GGCCTGTTACTGGGCTTTGGTGG - Intronic
955035588 3:55264110-55264132 GACCTCTTACTGGGCTTTTGTGG + Intergenic
956360456 3:68441456-68441478 GGCCTGTTACTGGGCTTTGGTGG + Intronic
956509664 3:69980390-69980412 GGCCTATTACTGGGCTTTTGTGG + Intergenic
956867042 3:73379977-73379999 GATCTGTGAATGGACTTTGGGGG + Intergenic
956900237 3:73707878-73707900 AACCTGCAACTGGGCCTTGGTGG - Intergenic
957247580 3:77733879-77733901 GGCCTGTTACAGAGCTTTGGTGG - Intergenic
957754601 3:84469444-84469466 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
958487674 3:94732456-94732478 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
958934306 3:100240646-100240668 GACCTGTTACTGGGCTTTGGTGG + Intergenic
959100162 3:102001083-102001105 AGCCTGCTACTGGGCCTTGGTGG - Intergenic
959203647 3:103279227-103279249 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
959439512 3:106359200-106359222 GGCCTTTTACTGGCCTTTGGTGG + Intergenic
959997863 3:112698338-112698360 GGCCTGCTACTGGGCTTTGGTGG + Intergenic
960349533 3:116575719-116575741 GGTCTGTTACTGGGCTTTGGTGG + Intronic
960494744 3:118360762-118360784 GGCCTGTTACTTGACTTTGGTGG - Intergenic
960982867 3:123248132-123248154 GCCCTGTTCCTGGTCTTAGGGGG - Intronic
961749486 3:129087024-129087046 GGCCTGTGCCTGGGCTTTGGGGG - Intergenic
963331813 3:143923355-143923377 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
963355659 3:144206842-144206864 GGCCCATTTCTGGGCTTTGGTGG - Intergenic
963453674 3:145516685-145516707 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
963630313 3:147723238-147723260 GGTCTGTTACTGGGCTTTGGTGG + Intergenic
963661397 3:148132163-148132185 GACCTGTTACTGGGCTTTGGTGG + Intergenic
964679241 3:159318896-159318918 GGCCTGTTACTGGGCTTTGGTGG - Intronic
965226763 3:166000746-166000768 GGCCTGTTAGTGGGCTTTGGTGG - Intergenic
965291739 3:166889570-166889592 CAGCTGTTACTGGGCTTTGGTGG - Intergenic
965334729 3:167422253-167422275 GAGCTGTTGCTGGGCAGTGGTGG - Intergenic
965384379 3:168028329-168028351 GTGCTGTTTCTGGGCTGTGGCGG - Intronic
966044326 3:175530903-175530925 GGCCTGTTACTGGGCTTTGGTGG - Intronic
966445697 3:179998577-179998599 GGTCTGTTACTGGGCTTTGGTGG + Intronic
966854350 3:184183969-184183991 GATCCATTACTGGCCTTTGGGGG - Exonic
967121029 3:186383162-186383184 GAGCTGATTCTGGGCTTTCGAGG + Intergenic
967831780 3:193926008-193926030 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
968666604 4:1825803-1825825 AACCTAGAACTGGGCTTTGGTGG - Intronic
968800187 4:2738139-2738161 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
968906950 4:3457985-3458007 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
969210683 4:5684904-5684926 GACCTGTTCTTGGCTTTTGGAGG - Intronic
971979291 4:33732855-33732877 GGCCTGCTATTGGGCTTTGGTGG - Intergenic
972805920 4:42529345-42529367 GGCTTGTTACTGGGCTTTGGTGG + Intronic
972882957 4:43448136-43448158 TGCCTGTGACTGGGCTTTGGTGG - Intergenic
972941249 4:44197397-44197419 GATCTGCTCCTGGGCCTTGGAGG - Intronic
973744062 4:53946238-53946260 GACTTGTGACTGGGGTCTGGAGG + Intronic
974262367 4:59542251-59542273 GGCCTGTTACTGGGTTTTGGTGG - Intergenic
974727216 4:65812541-65812563 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
974746911 4:66088887-66088909 GGTCTGTTACTGGGCTTTGGTGG - Intergenic
975384508 4:73740053-73740075 GAACTGTTACTGCTCTTAGGGGG - Intergenic
975656060 4:76642310-76642332 ACCCTGTTACATGGCTTTGGGGG - Intronic
975982612 4:80177259-80177281 GGCCTGTTACTGGGCTTTAGTGG - Intergenic
976034202 4:80795804-80795826 GGTCTGTTAGTGGGCTTTGGTGG - Intronic
977031626 4:91891425-91891447 TTTCTGTTACTGGGCTTTGGTGG + Intergenic
977204719 4:94155702-94155724 GGCCTGTTACTGGGCTTTAGTGG + Intergenic
977430770 4:96928230-96928252 GGCCTCTTACTGGGCTTTGGTGG + Intergenic
977466005 4:97383392-97383414 GGTCTGTTACTGGGCTTTGGTGG + Intronic
977626272 4:99192636-99192658 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
977701727 4:100029869-100029891 GGCCTGTTACTGGGTTTTGGTGG - Intergenic
977930408 4:102743801-102743823 GGCCTGTTACTGGGCTTTGGTGG - Intronic
978341586 4:107725531-107725553 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
978899071 4:113926800-113926822 GGCCTGTTACTGGGCTTTGGTGG - Intronic
978966856 4:114750960-114750982 GGGCTTTTACTGGGCTTTGGTGG + Intergenic
980387944 4:132111163-132111185 GGCCTGTTACTGGACTTTGGTGG - Intergenic
980405887 4:132353773-132353795 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
980497523 4:133605344-133605366 GGCCTGTTATTGGGCTTTGGTGG - Intergenic
980629525 4:135414304-135414326 GGCCTGTTACTGGGCTTTGATGG + Intergenic
980957735 4:139445935-139445957 GGCCTGTTACTGGGCTTTGGCGG + Intergenic
981835007 4:149043963-149043985 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
981873541 4:149515214-149515236 GGCCTGTTACTAGGCTTTGGTGG + Intergenic
982623337 4:157732883-157732905 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
982835543 4:160116659-160116681 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
982847772 4:160274314-160274336 GGCCTGTTACTGGGCTTTGTTGG + Intergenic
983027394 4:162755313-162755335 GGCCTGTTACTGGGATTTGGTGG + Intergenic
983185067 4:164691593-164691615 GGCCTCGTACTAGGCTTTGGTGG + Intergenic
983582679 4:169324830-169324852 GGCTTGTTACTGGGTTTTGGTGG + Intergenic
984060280 4:174982006-174982028 GGCCTGCTACTGGGCTTTGGTGG - Intergenic
986025577 5:3847432-3847454 GGCCTGTTGCTGGATTTTGGTGG + Intergenic
986037029 5:3950419-3950441 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
986087112 5:4462736-4462758 GGCCTGTTAGTGGGCTTTAGTGG + Intergenic
986742923 5:10719524-10719546 GGCCTGTTACTGGGCTTTGGTGG + Intronic
986938328 5:12918732-12918754 GGCCTATTACTGGGCTTTGGTGG - Intergenic
986959841 5:13199237-13199259 TGCCTGTTACTGGGCTTTCATGG + Intergenic
987138236 5:14919622-14919644 TACCTGTTACTTGGGTTTGATGG + Intergenic
987153180 5:15061684-15061706 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
987578338 5:19758293-19758315 GGCCTGTTACTGGACTTTGGTGG - Intronic
987657134 5:20821633-20821655 GGCCTATTACTGGGCTTTGGTGG - Intergenic
987885448 5:23806518-23806540 GGCCTATTACTGGGCTTCGGTGG + Intergenic
988056565 5:26105249-26105271 GGCCTGTTACTCGGCTTTGGTGG - Intergenic
988079827 5:26401401-26401423 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
988107762 5:26772565-26772587 GGCTTTTTGCTGGGCTTTGGTGG + Intergenic
988160821 5:27516852-27516874 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
988169198 5:27632819-27632841 GGCCAGTTACTGGGCTTTGGTGG - Intergenic
988188778 5:27901255-27901277 GGCCTGTTACTGGGCTTCGATGG + Intergenic
988233284 5:28507071-28507093 GACTTGTTACTGGGCTTTGGTGG - Intergenic
988766417 5:34382315-34382337 GGCCTATTACTGGGCTTTGGTGG + Intergenic
989307499 5:39974604-39974626 GGCCTATAACTGGGCTTTGGTGG - Intergenic
989457639 5:41661749-41661771 GGCCTGTTACTAGGCTTTGGTGG - Intergenic
989486380 5:41996340-41996362 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
989568499 5:42924454-42924476 GCCCTGCTACTGAGCCTTGGCGG + Intergenic
991033548 5:62105941-62105963 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
991946150 5:71900160-71900182 GGCCTGTTACTGGGCTTGGGTGG + Intergenic
993203395 5:84847559-84847581 GACCTGTTACTAAGCTTTGGTGG + Intergenic
993367464 5:87050937-87050959 GGTCTGTTACTGGGCTTTGGTGG - Intergenic
993412578 5:87591793-87591815 GGCCTGTTACTGGGTTTTGGTGG - Intergenic
993621391 5:90172361-90172383 GACCTGGTACTGAGCATTGGAGG - Intergenic
993780697 5:92062413-92062435 GACTTGTTACTGGGCTTTGGTGG + Intergenic
994224115 5:97232344-97232366 GACCTGCGACTGGCCTCTGGTGG + Intergenic
994291368 5:98031952-98031974 GGCCTGTTACTGGGGTTTGGTGG - Intergenic
994855432 5:105113565-105113587 GGCATGTTACTGGGCTTTGATGG - Intergenic
995269553 5:110205447-110205469 GGCCCAATACTGGGCTTTGGTGG - Intergenic
995427730 5:112043707-112043729 GGCCTGTTACTGGGCTTTGATGG - Intergenic
995776283 5:115727660-115727682 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
996825566 5:127677854-127677876 GGCCTGTTATTGGACTTCGGTGG + Intergenic
998290332 5:140908532-140908554 GGCCTATTACTGGGCTTTGGTGG - Intronic
998410501 5:141907006-141907028 GGCTTGTTCCTGGGCTCTGGTGG - Intergenic
999238648 5:150114855-150114877 GACCTGCTATGAGGCTTTGGAGG - Exonic
999351389 5:150874864-150874886 GGCCTGTCACTGGGTTTTGGTGG + Intronic
1000416976 5:160993921-160993943 GGCCTGTTATTGGGCTTTGGTGG + Intergenic
1001379244 5:171292557-171292579 CATCCCTTACTGGGCTTTGGTGG - Intronic
1001430444 5:171657282-171657304 GCCCTCTTCCCGGGCTTTGGAGG + Intergenic
1002570265 5:180136117-180136139 GACCCATTCCTGGGCTTTTGGGG - Intronic
1002997969 6:2304765-2304787 TGCCTGTCACTGGGCTTTGGTGG + Intergenic
1003695894 6:8406120-8406142 GGCCTGTTACAGGGCTTTGGTGG - Intergenic
1003758610 6:9150101-9150123 GGCCTGTTACTGGGCTTTGTTGG + Intergenic
1003791224 6:9550011-9550033 GGCCTATTACTGGGATTTGGTGG + Intergenic
1004474887 6:15962080-15962102 GTCCTGTTACATGGCCTTGGTGG - Intergenic
1004824285 6:19403216-19403238 GGACTGTTACTGGGCTTTGGTGG - Intergenic
1005185173 6:23157092-23157114 GGGCTGTTATTGGGCTTTGGTGG + Intergenic
1005713611 6:28525901-28525923 GCCCTGTGACTGGCCTGTGGGGG + Intronic
1005976213 6:30801811-30801833 GACCTGTTAGTTGGCTAGGGTGG + Intergenic
1006001560 6:30969095-30969117 GGCCTATTACTGGGCTTTGGTGG + Intergenic
1006273017 6:32978760-32978782 GGCCTGTTACTGGGCTACGCAGG - Intronic
1006949245 6:37807993-37808015 ATCCTCTTACTGGGCTTTGGAGG + Intergenic
1008079354 6:47178380-47178402 GGCCTGTTACTGGGCTTTGTTGG - Intergenic
1008266919 6:49439269-49439291 GGCCTGTTACTGGACTTTGGTGG - Intronic
1008337292 6:50322931-50322953 GACCTGTTGCTGGGGTATGGTGG - Intergenic
1008820402 6:55625172-55625194 GGCCTGTTAATGGGCTTTTGTGG + Intergenic
1009390108 6:63135058-63135080 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1009851923 6:69208938-69208960 GGCCTGTTACTGCGCTTTGGTGG - Intronic
1010108006 6:72190885-72190907 GGCCTGTTCCTGGGCTTTACTGG - Intronic
1010323581 6:74540509-74540531 GGCCTGTTACTGGGCTTTGATGG + Intergenic
1010325326 6:74556579-74556601 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1011069106 6:83361685-83361707 GGCCTGTTACTGGGCTTTGGTGG + Intronic
1012108565 6:95197717-95197739 GTCATGTTACTGGGCTTTGGTGG - Intergenic
1012344592 6:98170339-98170361 GGCCTATTACTGGGCTTTGGTGG + Intergenic
1012730465 6:102874339-102874361 GGCCTGTTACTGGGTTTTGGTGG + Intergenic
1012920791 6:105219525-105219547 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1013406675 6:109849822-109849844 GGCCAGTTACTGGGCTTTGGTGG + Intergenic
1014090983 6:117403153-117403175 GTCCTGTAACTGGGACTTGGAGG + Exonic
1014363393 6:120508334-120508356 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1014416990 6:121195409-121195431 GGCATGTTACTGGGCTTTGGTGG + Intronic
1014631644 6:123796821-123796843 GACCTGTTACTGGGCTTTGGTGG + Intergenic
1015443281 6:133272545-133272567 GGCCCATTACTGGGCTTTGGTGG - Intronic
1016147327 6:140692696-140692718 GGCCTGTTACTGGGCTTTCGTGG - Intergenic
1016174911 6:141069075-141069097 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1016419611 6:143870662-143870684 GGCCTGTTACTGGGCTTTGGTGG - Intronic
1016576254 6:145572567-145572589 GGTCTGTTACTGGGCTTTGGTGG - Intronic
1017388453 6:153912187-153912209 GGCCTGTTACCAGGCTTTGGTGG - Intergenic
1017977112 6:159368037-159368059 GGTTTGTTACTGGGCTTTGGTGG - Intergenic
1018122924 6:160655203-160655225 GGTCTGTTATTGGGCTTTGGTGG - Intronic
1018599891 6:165527546-165527568 GGCCTGGTACTGGGCTTTGGTGG + Intronic
1018803788 6:167242971-167242993 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1019178786 6:170174860-170174882 GGCCTCCTCCTGGGCTTTGGTGG + Intergenic
1020396721 7:7725534-7725556 GGCCTGTTACTGGGCTTTGGTGG + Intronic
1020710353 7:11597645-11597667 GGCCTGTTACTGGGCTTTGGTGG + Intronic
1021988813 7:26122942-26122964 GGCCTGTTACTGGGCCTTGGTGG + Intergenic
1022078889 7:27000348-27000370 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
1024040541 7:45550164-45550186 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
1024744210 7:52388463-52388485 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
1024884339 7:54124635-54124657 TGCCTATTACTGGGCTTTGGTGG - Intergenic
1025015074 7:55432893-55432915 GGCCTGTTGATGGGCTTTGCAGG + Exonic
1025282084 7:57634852-57634874 TACCTGTTGATGGGGTTTGGGGG + Intergenic
1025302646 7:57830665-57830687 TACCTGTTGATGGGGTTTGGGGG - Intergenic
1026046486 7:66909079-66909101 CACTTATTACTGGGCTTTGGTGG - Intergenic
1027303688 7:76869286-76869308 CACCTGTTCCTGGGGTTTGAAGG - Intergenic
1028043863 7:86091485-86091507 GGCCTGTTACTAGGCTTTGGTGG + Intergenic
1028141739 7:87282003-87282025 GGCCTGTTATTGGGATTTGGTGG + Intergenic
1028237824 7:88382840-88382862 GGCCTATTACTGGGCTTTGGTGG + Intergenic
1028935017 7:96455082-96455104 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
1029244117 7:99186325-99186347 GAACTGTTGCTGGGCTTTACTGG - Intronic
1029261276 7:99304434-99304456 GACATGCTGCTGGGGTTTGGTGG - Intergenic
1030277461 7:107736133-107736155 GGCCTGTTACTAGGCTTTGGTGG + Intergenic
1030368757 7:108674046-108674068 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
1030931284 7:115525664-115525686 GGCCCATTACAGGGCTTTGGTGG - Intergenic
1031108998 7:117582856-117582878 GGGCTGTTTCTGGTCTTTGGAGG + Intronic
1031278714 7:119767168-119767190 GGCCTGTTGCTGGGCTTTCTGGG + Intergenic
1031676561 7:124618383-124618405 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
1031832999 7:126650035-126650057 GTCCCGTTACTGGGCTTTGGTGG + Intronic
1032153102 7:129446939-129446961 GGCCTGTTACTGGTCTTTGGTGG - Intronic
1033076261 7:138253064-138253086 GGCCTCTTACTGGGCTTTGGTGG + Intergenic
1034298036 7:149991378-149991400 GACCTCAAACTGGGCTGTGGTGG + Intergenic
1035370423 7:158376268-158376290 GACGTGTGACAGGGCTGTGGGGG - Intronic
1035370530 7:158376630-158376652 GACGTGTGACAGGGCTGTGGGGG - Intronic
1035370543 7:158376675-158376697 GACGTGTGACAGGGCTGTGGGGG - Intronic
1035370607 7:158376900-158376922 GACGTGTGACAGGGCTGTGGGGG - Intronic
1035370620 7:158376945-158376967 GACGTGTGACAGGGCTGTGGGGG - Intronic
1035370645 7:158377035-158377057 GACGTGTGACAGGGCTGTGGGGG - Intronic
1035370660 7:158377080-158377102 GACGTGTGACAGGGCTGTGGGGG - Intronic
1035370675 7:158377125-158377147 GACGTGTGACAGGGCTGTGGGGG - Intronic
1035370690 7:158377170-158377192 GACGTGTGACAGGGCTGTGGGGG - Intronic
1035370705 7:158377215-158377237 GACGTGTGACAGGGCTGTGGGGG - Intronic
1038302285 8:26363732-26363754 GACCTGTTACTGGGATCTTCAGG - Exonic
1038454461 8:27663619-27663641 GACCTTCTACTGGGCCTTGGTGG - Intronic
1039324165 8:36466507-36466529 GGCCTGTTGATGGGCTTTGGTGG - Intergenic
1041412638 8:57573764-57573786 GGCATGTCACTGGGCTCTGGTGG - Intergenic
1041934556 8:63321348-63321370 GGCCTGTTACTGGACTTTGGTGG + Intergenic
1041986185 8:63924491-63924513 GGCCTGTCACTGGGCTTTGGTGG + Intergenic
1043259968 8:78184175-78184197 GACCTGGTACTGGGCTTTGGTGG - Intergenic
1044150802 8:88773093-88773115 TGCCTGTTAGTGGACTTTGGTGG + Intergenic
1044202393 8:89452506-89452528 GGCCCATTACTGGGCTTTGGTGG + Intergenic
1044487148 8:92767104-92767126 GGCCTGTTACTGGGCTTTAGTGG - Intergenic
1045221842 8:100207083-100207105 GGCCTGTTACTGGGCTTTGGTGG + Intronic
1045391288 8:101717381-101717403 GACCAGTTACTGGTGTTTGTAGG + Intronic
1046128670 8:109941584-109941606 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1046197561 8:110884241-110884263 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
1046417634 8:113937776-113937798 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1046585782 8:116147701-116147723 GGCCTGTTACTGGGTTTTGGTGG - Intergenic
1046766204 8:118073011-118073033 GACCTGATACTGGACTTCAGGGG + Intronic
1050482678 9:6102621-6102643 GGCCTATTACTGGGCTTTGGTGG + Intergenic
1050872789 9:10594984-10595006 AACCTGTCATTGAGCTTTGGGGG - Intronic
1051882150 9:21850680-21850702 GGCCTGTTACTGGACTTTGGTGG + Intronic
1052227593 9:26108394-26108416 GGCCTGTTACTGGGCTTTGGTGG + Intronic
1052368655 9:27640854-27640876 GGCCTGTTACTAGGCTTTGGTGG + Intergenic
1052442266 9:28512264-28512286 GGCCTGTTACTGGGCTTTAGTGG - Intronic
1054744695 9:68842843-68842865 TATCTGATACTGGGCTTTGAAGG + Intronic
1055829930 9:80366261-80366283 GACTTGGCACTGGGCTTTAGGGG + Intergenic
1055903936 9:81271186-81271208 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1056156670 9:83845227-83845249 GGCCTGTTACTGGGCTTTGGTGG + Intronic
1056314231 9:85372927-85372949 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1056353868 9:85778300-85778322 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1058122485 9:101154386-101154408 GACCTGTTATTGGTCTTTTCAGG + Intronic
1058259252 9:102809650-102809672 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1058503784 9:105648683-105648705 GACCTTTGACTTGGCTTTGGAGG - Intergenic
1059196502 9:112375850-112375872 AGCCTGTTACTGGGCTTTGGTGG - Intergenic
1059251305 9:112890131-112890153 GACCTGATGCTGGGCTTGGCGGG - Exonic
1060079885 9:120633265-120633287 TACCTGTTACTGGGCTGTCCAGG + Intronic
1060771853 9:126337713-126337735 GACCTGTTAGTGTGTTTTGCGGG + Intronic
1062135474 9:134925041-134925063 GACCTGTTACAGGGCTTTAATGG + Intergenic
1203633157 Un_KI270750v1:88474-88496 TACCTGTTGATGGGGTTTGGGGG + Intergenic
1186279499 X:7977136-7977158 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
1186478828 X:9880213-9880235 GACCTCTTAGTGGGCTTAGCAGG + Intronic
1186723430 X:12330304-12330326 GTGCTCTTACTTGGCTTTGGGGG - Intronic
1186965197 X:14779343-14779365 GACATTTAACTGGGCTTTGGTGG + Intergenic
1189154880 X:38746704-38746726 GGCCTGTTACTGGGATTTGGTGG - Intergenic
1190055588 X:47179442-47179464 GCCCTGTGACAGGGCTTGGGAGG - Exonic
1190709136 X:53053836-53053858 GACCATGTACTGGGCTTTTGTGG + Intronic
1190996745 X:55617465-55617487 GACCTGTTACTGGGCTTTGGTGG - Intergenic
1191134031 X:57044470-57044492 GGCCTGTTACTGGGCATTCATGG - Intergenic
1191630034 X:63312571-63312593 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1191719237 X:64215692-64215714 CGCCTGTTACTGGGCTTTGGTGG - Intergenic
1191742537 X:64451291-64451313 GGCCTGTTACTGGGCTTTGATGG - Intergenic
1191759363 X:64629941-64629963 AGCCTGTTACTGGGCTTTAGTGG + Intergenic
1191769492 X:64740081-64740103 GGCCTGTTACTGGGCTTTAGTGG - Intergenic
1191941257 X:66483848-66483870 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1191946356 X:66539028-66539050 GGTCTGTTACTGGGCTTTAGTGG + Intergenic
1192898707 X:75471926-75471948 GGCCTATTACTGGGCTTTGGTGG + Intronic
1193053493 X:77125784-77125806 GGCCTGTTACTGGGCTTTGATGG + Intergenic
1193072021 X:77316122-77316144 GGCCTGTTCCTGGGCTTTTTTGG - Intergenic
1193176574 X:78401264-78401286 GACCTTTTAATGGGGTTTTGTGG - Intergenic
1193297785 X:79852690-79852712 GGCCTGTTACTGGGGTTTGGTGG + Intergenic
1193356258 X:80523139-80523161 GGCCTGTTACTGGGCTTCAGTGG + Intergenic
1193447159 X:81618787-81618809 GGCCTATTACTGGACTTTGGTGG + Intergenic
1193573666 X:83174915-83174937 GGCCTGTTACTGAGCTTTGGTGG - Intergenic
1193832951 X:86310113-86310135 GACCTGTTACTGGGCTTTGGTGG + Intronic
1193904489 X:87225847-87225869 TGACTATTACTGGGCTTTGGTGG + Intergenic
1193957288 X:87878226-87878248 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
1194179587 X:90695919-90695941 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1194210279 X:91062370-91062392 GGCCTGTTACTGTGCTTTCGTGG + Intergenic
1194604386 X:95961952-95961974 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1194849242 X:98852158-98852180 GGTCTGTTACTGGGCTTTGGTGG - Intergenic
1195782349 X:108479849-108479871 GGCCTGTTACTGGGCTTTGGCGG - Intronic
1196135965 X:112209827-112209849 GGACTGTTACTGGGCTTTGGTGG - Intergenic
1196432300 X:115639542-115639564 TTCCTGTTACTGGGCTTTGAAGG - Intronic
1197002293 X:121452940-121452962 GGTCTGTTACTGGGCCTTGGTGG + Intergenic
1197245043 X:124158978-124159000 GGCCTGTTACTGGGTTTTAGTGG - Intronic
1197379997 X:125727889-125727911 AGCCTGTTACTGGGCTTAGGTGG - Intergenic
1197386770 X:125812227-125812249 GGCCTGTTACTAGGCTTTGATGG - Intergenic
1197405089 X:126039214-126039236 GGCCTGTTACTGAGCTTTGGTGG + Intergenic
1197409322 X:126096399-126096421 TGCCTGTTACTGAGCTTTGGTGG - Intergenic
1197474479 X:126903992-126904014 CACCTGGTCCTGGGCTTTTGGGG - Intergenic
1197477355 X:126941313-126941335 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1197591869 X:128419403-128419425 AGCCTGTTACTGGGCTTTGGTGG + Intergenic
1198531665 X:137554303-137554325 GATGTGTTACTGGGGTTTGCTGG - Intergenic
1198701303 X:139400312-139400334 GGCCTGTTACTGGGCTTTGATGG + Intergenic
1198783036 X:140257781-140257803 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1198934043 X:141887895-141887917 GGCCTGTTACTGGGCTTTCATGG + Intronic
1199024382 X:142919735-142919757 GGACTGTTACCGGGCTTTAGTGG + Intergenic
1199040594 X:143111116-143111138 GGTCTGTTACTGGGCTTTGATGG + Intergenic
1199144438 X:144348949-144348971 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1199310423 X:146314384-146314406 GGCCCGTTACTGGGCTTTGGTGG - Intergenic
1200340491 X:155390626-155390648 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1200521274 Y:4212046-4212068 GGCCTGTTACTGGGCTTTGGTGG + Intergenic
1200526249 Y:4278088-4278110 GGCCTGTTACTGGGCTTTGGTGG - Intergenic
1200746052 Y:6904856-6904878 GGCTTATTACTGGGCTTTGGGGG - Intergenic
1200920057 Y:8605248-8605270 GACCTGTCACTGTGCAATGGTGG - Intergenic
1200921596 Y:8618224-8618246 GACCTGTTGCTAGGCAATGGTGG - Intergenic
1200976631 Y:9218496-9218518 GGCCTGTTACTGGACTTTGTTGG + Intergenic
1201796625 Y:17903395-17903417 GGCCCATTGCTGGGCTTTGGTGG - Intergenic
1201804930 Y:18002590-18002612 GGCCCATTGCTGGGCTTTGGTGG + Intergenic
1202134540 Y:21648061-21648083 GGCCTGTTACTGGACTTTGTTGG - Intergenic