ID: 1190996746

View in Genome Browser
Species Human (GRCh38)
Location X:55617468-55617490
Sequence TTTGACCTGTTACTGGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190996746_1190996752 9 Left 1190996746 X:55617468-55617490 CCAAAGCCCAGTAACAGGTCAAA No data
Right 1190996752 X:55617500-55617522 GTTATCTACAGAAGATGGCAGGG No data
1190996746_1190996750 4 Left 1190996746 X:55617468-55617490 CCAAAGCCCAGTAACAGGTCAAA No data
Right 1190996750 X:55617495-55617517 GAGTAGTTATCTACAGAAGATGG No data
1190996746_1190996751 8 Left 1190996746 X:55617468-55617490 CCAAAGCCCAGTAACAGGTCAAA No data
Right 1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190996746 Original CRISPR TTTGACCTGTTACTGGGCTT TGG (reversed) Intergenic
No off target data available for this crispr