ID: 1190996750

View in Genome Browser
Species Human (GRCh38)
Location X:55617495-55617517
Sequence GAGTAGTTATCTACAGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1190996746_1190996750 4 Left 1190996746 X:55617468-55617490 CCAAAGCCCAGTAACAGGTCAAA No data
Right 1190996750 X:55617495-55617517 GAGTAGTTATCTACAGAAGATGG No data
1190996748_1190996750 -2 Left 1190996748 X:55617474-55617496 CCCAGTAACAGGTCAAAAGGAGA No data
Right 1190996750 X:55617495-55617517 GAGTAGTTATCTACAGAAGATGG No data
1190996742_1190996750 29 Left 1190996742 X:55617443-55617465 CCCAGAGTCAAATGTTCACTTTC No data
Right 1190996750 X:55617495-55617517 GAGTAGTTATCTACAGAAGATGG No data
1190996749_1190996750 -3 Left 1190996749 X:55617475-55617497 CCAGTAACAGGTCAAAAGGAGAG No data
Right 1190996750 X:55617495-55617517 GAGTAGTTATCTACAGAAGATGG No data
1190996745_1190996750 7 Left 1190996745 X:55617465-55617487 CCACCAAAGCCCAGTAACAGGTC 0: 7
1: 150
2: 161
3: 101
4: 201
Right 1190996750 X:55617495-55617517 GAGTAGTTATCTACAGAAGATGG No data
1190996743_1190996750 28 Left 1190996743 X:55617444-55617466 CCAGAGTCAAATGTTCACTTTCC No data
Right 1190996750 X:55617495-55617517 GAGTAGTTATCTACAGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1190996750 Original CRISPR GAGTAGTTATCTACAGAAGA TGG Intergenic
No off target data available for this crispr