ID: 1191006523

View in Genome Browser
Species Human (GRCh38)
Location X:55716156-55716178
Sequence AGAAAGGCGGGTCCGTGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191006523_1191006533 19 Left 1191006523 X:55716156-55716178 CCTAGCCACGGACCCGCCTTTCT No data
Right 1191006533 X:55716198-55716220 CCCGCTCCTGTATCATAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191006523 Original CRISPR AGAAAGGCGGGTCCGTGGCT AGG (reversed) Intergenic
No off target data available for this crispr