ID: 1191006525

View in Genome Browser
Species Human (GRCh38)
Location X:55716168-55716190
Sequence AGTGCTGGGCAGAGAAAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191006525_1191006533 7 Left 1191006525 X:55716168-55716190 CCCGCCTTTCTCTGCCCAGCACT No data
Right 1191006533 X:55716198-55716220 CCCGCTCCTGTATCATAAGCTGG No data
1191006525_1191006536 23 Left 1191006525 X:55716168-55716190 CCCGCCTTTCTCTGCCCAGCACT No data
Right 1191006536 X:55716214-55716236 AAGCTGGTGCATCTGAATGCAGG No data
1191006525_1191006537 24 Left 1191006525 X:55716168-55716190 CCCGCCTTTCTCTGCCCAGCACT No data
Right 1191006537 X:55716215-55716237 AGCTGGTGCATCTGAATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191006525 Original CRISPR AGTGCTGGGCAGAGAAAGGC GGG (reversed) Intergenic
No off target data available for this crispr