ID: 1191006533

View in Genome Browser
Species Human (GRCh38)
Location X:55716198-55716220
Sequence CCCGCTCCTGTATCATAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191006528_1191006533 -7 Left 1191006528 X:55716182-55716204 CCCAGCACTTTCCTGCCCCGCTC No data
Right 1191006533 X:55716198-55716220 CCCGCTCCTGTATCATAAGCTGG No data
1191006524_1191006533 14 Left 1191006524 X:55716161-55716183 CCACGGACCCGCCTTTCTCTGCC No data
Right 1191006533 X:55716198-55716220 CCCGCTCCTGTATCATAAGCTGG No data
1191006527_1191006533 3 Left 1191006527 X:55716172-55716194 CCTTTCTCTGCCCAGCACTTTCC No data
Right 1191006533 X:55716198-55716220 CCCGCTCCTGTATCATAAGCTGG No data
1191006526_1191006533 6 Left 1191006526 X:55716169-55716191 CCGCCTTTCTCTGCCCAGCACTT No data
Right 1191006533 X:55716198-55716220 CCCGCTCCTGTATCATAAGCTGG No data
1191006522_1191006533 20 Left 1191006522 X:55716155-55716177 CCCTAGCCACGGACCCGCCTTTC No data
Right 1191006533 X:55716198-55716220 CCCGCTCCTGTATCATAAGCTGG No data
1191006529_1191006533 -8 Left 1191006529 X:55716183-55716205 CCAGCACTTTCCTGCCCCGCTCC No data
Right 1191006533 X:55716198-55716220 CCCGCTCCTGTATCATAAGCTGG No data
1191006523_1191006533 19 Left 1191006523 X:55716156-55716178 CCTAGCCACGGACCCGCCTTTCT No data
Right 1191006533 X:55716198-55716220 CCCGCTCCTGTATCATAAGCTGG No data
1191006525_1191006533 7 Left 1191006525 X:55716168-55716190 CCCGCCTTTCTCTGCCCAGCACT No data
Right 1191006533 X:55716198-55716220 CCCGCTCCTGTATCATAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191006533 Original CRISPR CCCGCTCCTGTATCATAAGC TGG Intergenic
No off target data available for this crispr