ID: 1191008545

View in Genome Browser
Species Human (GRCh38)
Location X:55737532-55737554
Sequence CAGTTTTTCACCACTGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 534
Summary {0: 1, 1: 1, 2: 8, 3: 54, 4: 470}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191008544_1191008545 -1 Left 1191008544 X:55737510-55737532 CCTGACTGCTGGGGTAGAACTGC 0: 1
1: 1
2: 9
3: 35
4: 130
Right 1191008545 X:55737532-55737554 CAGTTTTTCACCACTGAGCATGG 0: 1
1: 1
2: 8
3: 54
4: 470
1191008539_1191008545 21 Left 1191008539 X:55737488-55737510 CCCTTCATGAGCACTGGAGCTGC 0: 1
1: 1
2: 4
3: 35
4: 214
Right 1191008545 X:55737532-55737554 CAGTTTTTCACCACTGAGCATGG 0: 1
1: 1
2: 8
3: 54
4: 470
1191008540_1191008545 20 Left 1191008540 X:55737489-55737511 CCTTCATGAGCACTGGAGCTGCC 0: 1
1: 1
2: 6
3: 40
4: 238
Right 1191008545 X:55737532-55737554 CAGTTTTTCACCACTGAGCATGG 0: 1
1: 1
2: 8
3: 54
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191008545 Original CRISPR CAGTTTTTCACCACTGAGCA TGG Intronic
900123991 1:1061514-1061536 CAGGCTTTCACCCCTGAGAATGG - Intergenic
900801484 1:4739758-4739780 CTGTTCTTCACCACACAGCATGG + Intronic
901903829 1:12390994-12391016 CAGTTTTTGACCACTCAGAGAGG + Intronic
901908922 1:12438583-12438605 CTGTGTTTCCCCACTGAACAGGG - Intronic
902694661 1:18132376-18132398 CAGATTCCCATCACTGAGCATGG + Intronic
904003592 1:27351654-27351676 TGGGCTTTCACCACTGAGCAGGG + Intronic
904198200 1:28801795-28801817 CAGCTTCTCTCCACAGAGCATGG - Intergenic
904336027 1:29798668-29798690 CAGTTTTTGACCACTCAGAGAGG - Intergenic
905400596 1:37700031-37700053 CAGGTTTTGACTAGTGAGCAAGG + Intronic
905914876 1:41677892-41677914 CATCTTTTCAACACTGTGCAGGG - Intronic
906050577 1:42868095-42868117 CAGTTTTTGACCACTCAGAGAGG - Intergenic
906272498 1:44491595-44491617 CAGTCTTTCACCATTAAGCATGG - Intronic
906804783 1:48770171-48770193 CAGTTTTGCACCACAGAGGAAGG - Intronic
906930829 1:50167829-50167851 CAGTTTTTGACCACTCAGAGAGG + Intronic
910588305 1:88902404-88902426 CAGTTTTTCACCACTCAGAGAGG - Intergenic
910790424 1:91044423-91044445 CAGTTTTTGACCACTCAGAGAGG - Intergenic
910831008 1:91462741-91462763 CAGTTTTTGACCACTCAGAGAGG + Intergenic
911012639 1:93297482-93297504 CAGTTTTTCACCATTAAGTATGG - Intergenic
911419005 1:97615744-97615766 CAGTGTTTCACTCCTTAGCAAGG + Intronic
911665941 1:100551983-100552005 CAGTTTTTCCCCATTCAGTATGG + Intergenic
911883665 1:103271143-103271165 CAGTTTTTGACCACTCAGAGAGG - Intergenic
913033474 1:114936444-114936466 CAGTTTTTGCCCACTCAGTATGG - Intronic
913996124 1:143653023-143653045 CAGGTGTTCACCGCTGTGCAGGG - Intergenic
915618437 1:157061045-157061067 CAGTCTTTCACCAGTGAGTATGG + Intergenic
915947038 1:160160740-160160762 CAATCTTTCAGCACAGAGCAGGG - Intronic
916285419 1:163100200-163100222 CAGTTTTTGACCACTCAGAGAGG - Intergenic
917372785 1:174313611-174313633 CAGTTTTTCTCCATTCAGTATGG + Intronic
917462792 1:175246837-175246859 CAGTTTTTGACCACTCAGAGAGG - Intergenic
917764623 1:178202691-178202713 CAGTTTTTGACCACTCAGAGAGG - Intronic
917802243 1:178581375-178581397 CTATTCCTCACCACTGAGCAAGG - Intergenic
918678185 1:187316774-187316796 CAGTTTTTCACCATTGAGTATGG - Intergenic
918774583 1:188611430-188611452 CAGTTTTTGACCACTCAGAGAGG - Intergenic
918815159 1:189171902-189171924 CAGTTTTTGACCACTCAGAGAGG - Intergenic
919241862 1:194924884-194924906 CAGTTTTTGACCACTCAGAGAGG - Intergenic
919734807 1:200940517-200940539 CAGTCTTTCACCATTAAGTATGG + Intergenic
921004165 1:211076244-211076266 CAGTGTTTGACCTCTGAGAATGG + Intronic
921915654 1:220607621-220607643 CAGTTTTTGCCCATTGAGTATGG + Intronic
923429064 1:233903808-233903830 TAGTTTCTCACCATTAAGCATGG + Intergenic
923743631 1:236680080-236680102 CAGATTTTCAGCACTAAGAATGG + Intergenic
923775067 1:236970609-236970631 CACCTTTCCACCTCTGAGCAAGG - Intergenic
923902596 1:238344093-238344115 CAGTCTTTCACCATCGAGAATGG + Intergenic
924099371 1:240587968-240587990 CAGTTTTCCATCAAAGAGCAAGG - Intronic
1065607104 10:27429165-27429187 CATTTTTTCCCCACTCAGAAAGG - Intergenic
1065766893 10:29038659-29038681 CAATTTTGGACCACAGAGCAAGG - Intergenic
1066582371 10:36895056-36895078 CAGTTTTTGACCATTCAGTATGG + Intergenic
1066701322 10:38132200-38132222 TAGTTTTTCACCACTGATTATGG + Intergenic
1066754118 10:38692479-38692501 CAGTTTTTCCCAACTGAGCTTGG - Intergenic
1066957716 10:42188735-42188757 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1068007579 10:51408900-51408922 CAGTTTTTGACCACTCAGAGAGG + Intronic
1069192216 10:65505690-65505712 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1070599433 10:77855545-77855567 CACTTTGTAACCAATGAGCATGG + Intronic
1071364388 10:84883843-84883865 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1071378464 10:85034039-85034061 CAGTTTTTGACCACTCAGGATGG - Intergenic
1072360558 10:94654824-94654846 CAGTTTTTCACCACTAAGAGAGG - Intergenic
1072944357 10:99796539-99796561 CAGGTTTGCACCACTGCACACGG - Intronic
1073743024 10:106432871-106432893 CAGTATTTCACCATTTAGTATGG - Intergenic
1074376170 10:112942526-112942548 CATTTTTTCACAACTAGGCATGG - Intergenic
1075619802 10:123917758-123917780 CAGCTTTTCAGGACTGAGAAAGG + Intronic
1076048655 10:127314972-127314994 CAGCTGGTCACCACGGAGCAGGG + Intronic
1076305853 10:129465587-129465609 CACTTTTTCCCCACTGAACCTGG - Intergenic
1076602393 10:131667269-131667291 TGGTCTTTCACCACTGACCAGGG + Intergenic
1076927311 10:133498535-133498557 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1078945574 11:16064908-16064930 CTGTTTTTCTCCATTGAGTATGG - Intronic
1079750855 11:24194896-24194918 CAGGGTTTCACCACAGTGCATGG - Intergenic
1081219103 11:40438143-40438165 CTGTTTTTCACCACTAGGCATGG + Intronic
1081609150 11:44548534-44548556 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1082619196 11:55399618-55399640 CATTTTTTCACCCCTCTGCACGG - Intergenic
1082999751 11:59280521-59280543 CAGTTTTTGACCAGTGAGAGAGG - Intergenic
1083914515 11:65731982-65732004 CAATGTTTCACCATTGAGTATGG + Intergenic
1084763945 11:71295265-71295287 CAGGTTTTGACCACTGAGATGGG + Intergenic
1084869372 11:72086805-72086827 GAGTTATGCACCACTGAACATGG - Intronic
1085362813 11:75907307-75907329 GAGTCTTTCACCATTGAGTATGG + Intronic
1086211453 11:84325110-84325132 CAGTTTTTCACCATTGAGTATGG + Intronic
1086552563 11:88069380-88069402 CAATTGGGCACCACTGAGCAGGG - Intergenic
1086834210 11:91601048-91601070 CAGTTCTTAACCACTCAGAAAGG - Intergenic
1087206179 11:95397383-95397405 CAGTCCTTCACCATTAAGCATGG - Intergenic
1087374108 11:97321203-97321225 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1087489756 11:98810044-98810066 TAGTTTTCCACCAAAGAGCAAGG - Intergenic
1088096895 11:106111630-106111652 CAGATGTGCACCACTGAGCTTGG - Intergenic
1088097300 11:106115813-106115835 CAGTTTTTGACCACTTAGAGAGG - Intergenic
1088191565 11:107233840-107233862 CAGTTTTTGACCTCTCAGAAAGG + Intergenic
1088786927 11:113190584-113190606 CAGCTTTTCACCACTCATCAGGG - Intronic
1089251721 11:117168280-117168302 CTGTTTTTCACTGCTAAGCATGG - Exonic
1091051832 11:132379412-132379434 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1091126030 11:133098714-133098736 TAGTTTCTCACCACTAAGTATGG - Intronic
1091608848 12:1985511-1985533 CAGTTTTACCTCACAGAGCATGG + Intronic
1092093372 12:5822306-5822328 CAGTTTTTGACCACTCAGAGAGG - Intronic
1092381643 12:8001586-8001608 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1092408029 12:8234275-8234297 CAGCTGTTCACCACCGAGCTAGG - Intergenic
1092609485 12:10156175-10156197 CAGTGTTGCACCACTAAGTATGG - Intergenic
1094102622 12:26779919-26779941 CAGTTTTTGACCACTCAGAGAGG - Intronic
1095198330 12:39351199-39351221 CAGCTTTTCACCACTGTTCTGGG - Intronic
1095844297 12:46729318-46729340 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1095981212 12:47975788-47975810 CAGTTTCCCAGCACTGATCATGG + Intronic
1096457372 12:51798792-51798814 CAGTTTTTGACCACTCAGAGAGG + Intronic
1096460075 12:51817462-51817484 CACTTTATCTCCACTGAGAATGG + Intergenic
1097437745 12:59571597-59571619 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1097564560 12:61251787-61251809 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1097821261 12:64131252-64131274 CAGTTTTTGACCACTCAGAGAGG + Intronic
1098605280 12:72382055-72382077 GAGTCTTTAACCTCTGAGCATGG - Intronic
1098716187 12:73830465-73830487 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1098733377 12:74066287-74066309 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1099228973 12:80001361-80001383 CAGTTGTGCACCACTGTGCCTGG - Intergenic
1099375740 12:81894614-81894636 CAGTTTTTGACCACTGAGAGAGG - Intergenic
1099401114 12:82204702-82204724 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1099490587 12:83283595-83283617 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1099670476 12:85685483-85685505 CAGTTTTGAACCACTGAGATTGG - Intergenic
1099673278 12:85722460-85722482 CACTTTTTCAACAGTGAGGAAGG + Intergenic
1099735873 12:86565693-86565715 CAGTTTTTGACCACTCAGAGAGG - Intronic
1100241054 12:92710951-92710973 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1101815052 12:108139873-108139895 CAGCTTTTCACTGCTGAGCTAGG - Intronic
1103194637 12:119032352-119032374 CAGTGTTTCACCACTAAGCATGG + Intronic
1103222369 12:119256520-119256542 CAGTTTTTCATCTGTGAGAAGGG - Intergenic
1103396625 12:120612104-120612126 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1103429474 12:120870578-120870600 CATTCTTTCATCACTGGGCATGG - Intronic
1103694519 12:122803796-122803818 CTATTTTTCACTACTGAACAAGG + Intronic
1103809786 12:123604109-123604131 CTGTTTTTAAACACTGAGCTGGG + Intronic
1103858337 12:123990717-123990739 CAGTCTTTCACAACTGGCCAGGG - Intronic
1104447819 12:128847095-128847117 TAGTTCTTCACCGCTGGGCATGG - Intergenic
1106352876 13:28951387-28951409 TAGTCTTTCACCACTGAGTATGG + Intronic
1107387477 13:39927764-39927786 CAGGGTTTCACCAGTTAGCAAGG - Intergenic
1107983488 13:45755306-45755328 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1108094816 13:46890591-46890613 CAGTTTCTGAGCACTGAGTACGG - Intronic
1108868810 13:54956951-54956973 CAGTTTTTTAACACTGAACATGG + Intergenic
1108914217 13:55588229-55588251 CAGTTTTTGACCACTCAGAAAGG + Intergenic
1109266851 13:60211172-60211194 CATAGTTTCAGCACTGAGCATGG - Intergenic
1109293312 13:60500771-60500793 CAGTTTTTGACCACTCAGAGTGG - Intronic
1109558374 13:64012677-64012699 CATTTTTCCACCATTGACCATGG + Intergenic
1112116377 13:96359956-96359978 CCCTATTCCACCACTGAGCAGGG + Intronic
1113319611 13:109221016-109221038 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1114442494 14:22761024-22761046 CAGTTCTTCAGCACTGAGCAAGG - Intergenic
1114747500 14:25165832-25165854 CAGTTTTTCCCTATTCAGCAGGG + Intergenic
1115059800 14:29174547-29174569 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1116068181 14:40009824-40009846 CAGTTTTTTACCACTCAGAGAGG - Intergenic
1116249138 14:42458290-42458312 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1116249562 14:42463536-42463558 CAGCTTCCCACCACTGAGCCTGG + Intergenic
1116728142 14:48588430-48588452 TAGTTTTTCTACACTGAGCTGGG + Intergenic
1116975225 14:51108544-51108566 CAGATTTTCACTAGTTAGCAAGG - Intergenic
1117216937 14:53560830-53560852 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1117850968 14:59968950-59968972 CAGTTTTTAAAGACTGAGTATGG + Intronic
1118037993 14:61889184-61889206 GGGTTTATAACCACTGAGCAGGG + Intergenic
1119059612 14:71461538-71461560 CAGTTTTTGACCACTCAGAGGGG + Intronic
1119107472 14:71938185-71938207 CAGTTTTTGACCACTCAGAAAGG + Intronic
1120067876 14:80065894-80065916 CTGTATTTAACCACTGTGCAAGG + Intergenic
1120498325 14:85262928-85262950 CAGTTTTTCACCATTCAGAGAGG + Intergenic
1120559604 14:85974540-85974562 CAGTGTTTGAGCACTGAGAATGG - Intergenic
1120596177 14:86440251-86440273 TAGTGTTTCACCACTAATCATGG - Intergenic
1120973794 14:90231492-90231514 CAGTTTTTAACCACTCAGAGAGG - Intergenic
1121110451 14:91309162-91309184 GAGGTTTTCATCACTGAGCCGGG + Intronic
1121442744 14:93959012-93959034 CAGTTTCTAACAACTGTGCAGGG + Intronic
1202935389 14_KI270725v1_random:83041-83063 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1125299234 15:38236960-38236982 GAGTTTTCTACCACTGATCAAGG - Intergenic
1126815498 15:52449521-52449543 CAGTGTTTCACCACTGACCCTGG + Intronic
1128105958 15:65045079-65045101 CAATATTTAACCACGGAGCAGGG - Intergenic
1129012612 15:72436178-72436200 CAGTTTTTCACCACTGAGTATGG + Intergenic
1131540687 15:93272571-93272593 CAGTCGTTCACCACTGTGCCTGG + Intergenic
1131724103 15:95203455-95203477 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1133348982 16:5089106-5089128 CAGCTGTTCACCACCGAGCTAGG - Exonic
1135192963 16:20369725-20369747 CAGTTTTTCTCCACTGGCAAAGG - Intronic
1135659602 16:24283873-24283895 CAGGTTTTCACCAAGAAGCATGG + Intronic
1136728610 16:32384610-32384632 CAGTTTTCCCCAACTGAGCTTGG + Intergenic
1137298041 16:47116099-47116121 CAGGTTTTCACCACTAAGTATGG + Intronic
1138734813 16:59238272-59238294 CAGTTTTTGGTCCCTGAGCAAGG - Intergenic
1138737604 16:59268987-59269009 CAGTTTAACACCAATGAGGAAGG - Intergenic
1141029788 16:80577863-80577885 CAGTTTTGCACTACTCGGCAAGG + Intergenic
1141866774 16:86755700-86755722 GTGTTCTTCACCACTGCGCAGGG + Intergenic
1141902713 16:87003102-87003124 CAGTTTGTCCCCACTGGTCAAGG - Intergenic
1142316282 16:89347812-89347834 CAGTTTTTCACCAGTAAGAATGG + Intronic
1202997827 16_KI270728v1_random:133133-133155 CAGTTTTCCCCAACTGAGCTTGG - Intergenic
1203024514 16_KI270728v1_random:445475-445497 CAGTTTTCCCCAACTGAGCTTGG - Intergenic
1142914619 17:3126099-3126121 CAGTTCCTCATCACTGAGCATGG + Intergenic
1143103160 17:4515000-4515022 CATTTAATGACCACTGAGCATGG + Intronic
1146238075 17:31186606-31186628 CAGTTTTTAACCACTCAGAGAGG - Intronic
1146593478 17:34149351-34149373 CAAATTTTCTCCAATGAGCATGG + Intronic
1146668234 17:34719232-34719254 CAGTTTTTAACCTCTGAAAATGG + Intergenic
1146754347 17:35414026-35414048 CAATGTTTCACCATTGAGCATGG - Intronic
1150061667 17:62073689-62073711 CAGTTTTTCACCATTATGAATGG + Intergenic
1151149626 17:72073783-72073805 CAGTGGTCCATCACTGAGCATGG + Intergenic
1152914035 17:83023640-83023662 AAGCGTTTCACCACAGAGCATGG - Intronic
1153089804 18:1330814-1330836 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1153131182 18:1857046-1857068 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1153217601 18:2834950-2834972 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1156303943 18:35859347-35859369 CAGTTTTTTACCACTCAGAGAGG - Intergenic
1157870845 18:51228944-51228966 CAGTTTTTGATCACTCAGAAAGG + Intergenic
1158102495 18:53845355-53845377 CAGCCTTTCACCATTGAGTATGG - Intergenic
1159151808 18:64532056-64532078 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1159287869 18:66376133-66376155 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1159665881 18:71159068-71159090 GAGTTTTCCACCTCTGACCACGG - Intergenic
1159711386 18:71764776-71764798 CAGTTTTTGACCACTCAGGGAGG - Intronic
1160092538 18:75840668-75840690 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1160704289 19:522711-522733 CAGTTTCCCAGCACTGAGCTGGG + Intergenic
1162520597 19:11177227-11177249 CAGGTTTGCACCACTGTGCTCGG + Intronic
1162895141 19:13760909-13760931 CAGGTTCCCACCACTGTGCATGG + Intronic
1163428002 19:17249761-17249783 CAGATGTGCACCACTGAGCCCGG + Exonic
1164099007 19:22037716-22037738 CAGTTTTTAACAACTGGGGAAGG + Intergenic
1164110698 19:22155395-22155417 AAGTTTTAAACCACTGAGCAAGG + Intergenic
1164493675 19:28737629-28737651 CAGTTTTTAAACAATGATCACGG + Intergenic
1166075979 19:40414065-40414087 CAGGGCTTCAGCACTGAGCATGG - Intergenic
1168179995 19:54655433-54655455 CAGTTATTCAAAGCTGAGCAGGG + Intronic
925256830 2:2497519-2497541 CACTTATTCTCCAATGAGCATGG - Intergenic
925280046 2:2677517-2677539 CAGTTTTTGACCACTCAGAGAGG - Intergenic
925460810 2:4061099-4061121 CAGTTTTTGACCACTCAGAGAGG - Intergenic
930295128 2:49544729-49544751 CAGTTTTTGACCACTCAGGGAGG + Intergenic
930467296 2:51771142-51771164 CAGTTTTTGCCCATTAAGCATGG + Intergenic
930536523 2:52651611-52651633 CAGTTTTTGACCACTCAGAAAGG + Intergenic
930728124 2:54701495-54701517 CAGTTTTTCCCCATTGTGTATGG - Intergenic
930910231 2:56621517-56621539 CAGTTTTTGACCACTCAGAGAGG - Intergenic
931296698 2:60934425-60934447 CAGTTTTTCACTGTTGAGTATGG + Intergenic
932258532 2:70307495-70307517 CAGGCTTGCACCACTGAGCCCGG + Intergenic
933240691 2:79917433-79917455 TAGTTTTTCACCTCAGAGAAAGG - Intronic
933265600 2:80177723-80177745 CAGTTTTTGACCACTCAGCGAGG + Intronic
934305833 2:91821249-91821271 CAGTTTTTGACCACTCAGAGAGG - Intergenic
934317418 2:91936816-91936838 CAGTTTTTCCCAACTGAGCTTGG - Intergenic
934327423 2:92031493-92031515 CAGTTTTTGACCACTCAGAGAGG + Intergenic
934465807 2:94262073-94262095 CAGTTTTTGACCACTCAGAGAGG + Intergenic
934872179 2:97876743-97876765 CAGTTTTTGCCCACTCAGTATGG - Intronic
936465146 2:112741440-112741462 CAGTTTTTGCCCACTGTCCAAGG - Intronic
937074666 2:119093062-119093084 CAGTTTGTCTCCATTGAGAATGG + Intergenic
937559423 2:123203630-123203652 CAGTTTTTCCCCATTCAGTATGG + Intergenic
938179148 2:129163936-129163958 AACTTTATGACCACTGAGCAAGG + Intergenic
938810644 2:134849708-134849730 ATGTTTTTCACTTCTGAGCAAGG - Intronic
940230015 2:151440994-151441016 CAGTATATTACCACTGGGCATGG + Intronic
941330576 2:164173911-164173933 CAGTTTTTGACCACTCAGAGAGG + Intergenic
941668109 2:168261783-168261805 CAGTTTTTGACCACTCAGAGAGG - Intergenic
943233639 2:185290480-185290502 CAGTTTTTGAGCTCTGAGAATGG + Intergenic
943479047 2:188395537-188395559 CAGATTTTCCCCACTGAGCCTGG + Intronic
943480273 2:188408824-188408846 CAGTTTTACACCACTGTGAATGG - Intronic
943517508 2:188906603-188906625 CAGTTTTTAACCACTCAGAGAGG + Intergenic
943664192 2:190591238-190591260 CACATTGTCACCACTGAGGAAGG - Intergenic
943679831 2:190756617-190756639 GACTTTTACAGCACTGAGCAGGG - Intergenic
945161981 2:206900951-206900973 CAGTTTTTCCCCATTCAGTATGG + Intergenic
945642266 2:212444490-212444512 CAGTTTTTGACCACTCAGTGAGG - Intronic
945667719 2:212762879-212762901 CAGTTTCTCCCCAGTCAGCAAGG + Intergenic
946527780 2:220539317-220539339 CAGTTTTTGACCACTCAGAAAGG + Intergenic
946766310 2:223044340-223044362 CAGATTTTCATCACAGGGCAGGG - Intergenic
1168991431 20:2099270-2099292 CAGTTTTTCCCCATTCAGTATGG - Intergenic
1170340268 20:15318854-15318876 CAGTCTTTCACCATTGACCATGG - Intronic
1171027320 20:21642591-21642613 CAGCTTTCCAACACTGAGCATGG + Intergenic
1171081875 20:22194761-22194783 CAGTGTTTGAGCACTGAGAACGG + Intergenic
1171402608 20:24886972-24886994 CAGTCTTTCACCATTGAGTATGG - Intergenic
1172721634 20:37003249-37003271 CACATCTTCACCACTGAACAAGG + Intronic
1173203807 20:40975232-40975254 CAGTTTTTCCCCATTCAGTATGG + Intergenic
1174041377 20:47702353-47702375 CAGTTTTTCATCTCTCAGCCAGG - Intronic
1174177115 20:48652152-48652174 CAGGTGTGCACCACTGCGCACGG - Intronic
1175039333 20:56031845-56031867 CACTTTGTCACCACTAAGCCTGG - Intergenic
1175893633 20:62326568-62326590 CTGTTTTCCACCACGGAGAATGG + Intronic
1176094570 20:63334069-63334091 GAGTGTTTCTCCACTGGGCAAGG - Intronic
1176097566 20:63351354-63351376 CAGTTTATCATCCCTGAGCTGGG + Intronic
1176417005 21:6481976-6481998 CAGATTTTCTCCAATTAGCAGGG + Intergenic
1176596809 21:8705277-8705299 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1176920161 21:14678594-14678616 CAGGTGTTGACCAGTGAGCAAGG - Intergenic
1177672223 21:24246946-24246968 CAGTTTTTCAACACTTAAGATGG + Intergenic
1177761242 21:25404309-25404331 CAGTTTTTCCCCATTCAGTATGG - Intergenic
1177970447 21:27782775-27782797 CAGTTTTTCACCATTCAGAATGG - Intergenic
1178012573 21:28304491-28304513 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1178012750 21:28305830-28305852 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1178270888 21:31188849-31188871 CAGGCTTTCACTACTGAGCCTGG + Intronic
1178952160 21:36994013-36994035 GAGTTTTTCACCACTGTGCTAGG - Intergenic
1179499322 21:41797148-41797170 CAGTTTTCCACCACACTGCATGG + Intergenic
1179692503 21:43090309-43090331 CAGATTTTCTCCAATTAGCAGGG + Intergenic
1179936150 21:44604687-44604709 CAGCTTTTCACCACTGAGTATGG + Intronic
1180279729 22:10682719-10682741 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1181367305 22:22387878-22387900 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1181713735 22:24708469-24708491 GAGTTTTTCAGCATTGAGTATGG - Intergenic
1182965750 22:34519613-34519635 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1184113388 22:42408532-42408554 CAGCTTTGCACCCCTGAGCCTGG + Intronic
1184603473 22:45557719-45557741 CAGTTTTTGACCACTCAGAGAGG + Intronic
1184859244 22:47163822-47163844 CACACTTGCACCACTGAGCAGGG + Intronic
949638994 3:6014169-6014191 CAGTTTTTGACCACTCAGAGAGG - Intergenic
950420729 3:12897586-12897608 CAGCATTGCAACACTGAGCAGGG - Exonic
950850991 3:16062246-16062268 CTGTTTTTCACAATAGAGCATGG + Intergenic
951291431 3:20876090-20876112 CAGTTTTTGACCACTCAGAGAGG + Intergenic
953043486 3:39275363-39275385 TAATTTTGCAGCACTGAGCAAGG - Intronic
953091586 3:39732091-39732113 CAACTTTTCACTACTGAGTATGG - Intergenic
953864063 3:46568594-46568616 CAGTTTTTCCCCATTCAGTAAGG - Intronic
956509751 3:69981026-69981048 CAGTTTTTGACCACTCAGAAAGG - Intergenic
956703807 3:71982236-71982258 CAGTTTTTGACCACTCAGAGAGG + Intergenic
957053313 3:75426449-75426471 CAGCTGTTCACCACCGAGCTAGG - Intergenic
957247480 3:77733242-77733264 CAGTTTTCGACCACTCAGAAAGG + Intergenic
957907191 3:86572580-86572602 CAGTTTTTCACCACTTAGTATGG + Intergenic
958004148 3:87791854-87791876 CAATTTTTCACCACTGAAACAGG - Intergenic
958934395 3:100241266-100241288 CAGTTTTTGACCACTCAGGGAGG - Intergenic
959226696 3:103596623-103596645 CAGTTTTTGACCACTCAGAGAGG + Intergenic
959745928 3:109776619-109776641 CAGTTTTTGACCACTCAGAGAGG + Intergenic
959997952 3:112698974-112698996 CAGTTTTTGACCACTGACAGAGG - Intergenic
960056034 3:113277108-113277130 CAGTTTTTAAGTTCTGAGCAAGG + Intronic
960260512 3:115562949-115562971 AAGTTTTTCACCACTTTCCAGGG + Intergenic
961088472 3:124090217-124090239 CAGGTTTTCACCACTTAACAAGG + Intronic
961262935 3:125617055-125617077 CAGTTTTTGACCACTCAGACAGG - Intergenic
961301512 3:125925094-125925116 CAGCTGTTCACCACCGAGCTAGG + Intergenic
961886953 3:130102763-130102785 CAGGTGTTCACCACCGAGCTAGG - Intronic
963331724 3:143922720-143922742 CAGTTTTTGACCACTCAGAGAGG + Intergenic
964679146 3:159318261-159318283 CAGTTTTTGACCACTCAGAGAGG + Intronic
965291660 3:166888938-166888960 CAGTTTTTGACCACTCAGAGAGG + Intergenic
965876546 3:173329644-173329666 CAGTCTTTCTCCAGGGAGCATGG + Intergenic
966218781 3:177530100-177530122 CAATTTTTTACCACTGAGTGGGG + Intergenic
966328921 3:178789734-178789756 CAGGTTCTGACCACTGAGAAGGG - Intronic
968010290 3:195270186-195270208 CAGTTTTTGACTTCTGAGGATGG - Intronic
968219068 3:196920618-196920640 CAGTTTTTCACTACTGTGTATGG + Intronic
968581382 4:1396977-1396999 CAGGTTGTCACCCATGAGCAAGG + Intergenic
969086077 4:4657519-4657541 CAGTTCTTCGTCACTGAGGAAGG - Intergenic
969625199 4:8299574-8299596 CAGTCTTTCACCATTAAGTACGG + Intronic
969757874 4:9161931-9161953 CAGCTGTTCACCACCGAGCTAGG + Intergenic
969817857 4:9699473-9699495 CAGCTGTTCACCACCGAGCTAGG + Intergenic
970109781 4:12624989-12625011 CAGATTTTCTCTGCTGAGCATGG + Intergenic
970719412 4:18968930-18968952 CAGTATTTCACCATTGATTAGGG + Intergenic
971110032 4:23574440-23574462 CAGCTTTTCACAATTGAGTAAGG - Intergenic
971126522 4:23760961-23760983 CAGTTTTTGACCACTCAGAGAGG - Intronic
971491894 4:27221488-27221510 CAGTTTTTCACCTTTGAGTTTGG + Intergenic
971857562 4:32062200-32062222 CAGTTTTTGACCACTCAGAGAGG + Intergenic
971979214 4:33732220-33732242 CAGTTTTTGTCCACTGAGAGAGG + Intergenic
972085308 4:35207750-35207772 CAGTTTTTTACCACTTAGAAAGG - Intergenic
972108991 4:35531193-35531215 CAGTTGTTCAGAAATGAGCATGG - Intergenic
972235460 4:37128163-37128185 CAGTTTTTCACCATTAAGTATGG - Intergenic
972967893 4:44534876-44534898 CAGTGTTTCAGCACTATGCATGG - Intergenic
973103001 4:46295395-46295417 CAGTTTTTAACCACTCAGAGGGG - Intronic
973118527 4:46489697-46489719 CAGTTTTTTACCACTTAGAGAGG - Intergenic
973229350 4:47824042-47824064 CAGTTGTTCACCAAGGAGCAAGG + Intronic
973559771 4:52123303-52123325 CAGTTGTTCACCAGTAAGTATGG + Intergenic
974289652 4:59913396-59913418 CAGTTTTTGACCACTCAGAGAGG - Intergenic
974564878 4:63568963-63568985 CAGTTTTTGACCACTCAGAGAGG - Intergenic
975841064 4:78474742-78474764 TTGTTTTTCACCACTGAGGATGG - Intronic
976305119 4:83552371-83552393 CAGTGATTCACAAATGAGCAGGG - Intronic
976734181 4:88294181-88294203 CATATTTTCACCCCTGTGCAGGG - Intergenic
977044803 4:92055822-92055844 CAGTTTTTCCCCATTCAGTATGG - Intergenic
978341493 4:107724895-107724917 CAGTTTTTGACCACTCAGAGAGG + Intergenic
978772070 4:112467134-112467156 CAGTTTTTGACTACTCAGAAAGG + Intergenic
979288430 4:118953375-118953397 CAGATTCTAACCCCTGAGCAGGG + Intronic
979449036 4:120847417-120847439 CAGTTCTTCACCACTGAACTGGG - Intronic
980405804 4:132353136-132353158 CAGTTTTTGACCACTCAGAGAGG + Intergenic
980594623 4:134937147-134937169 CAATTTTTCTCCATTGAGTATGG - Intergenic
980602294 4:135040675-135040697 CAGTTTTTTACCACTCAAAAAGG - Intergenic
981735833 4:147949409-147949431 CAGTGTTTCTCAACTGAGGATGG + Intronic
981835091 4:149044593-149044615 CAGTTTTTGACCACTCAGAGAGG - Intergenic
981880807 4:149609777-149609799 CAGTTTTTCTCCATTTAGAATGG - Intergenic
982355864 4:154467316-154467338 CAGTCTTTTACAAGTGAGCAAGG + Intronic
982835630 4:160117296-160117318 CAGTTTTTGACCACTCAGAGAGG - Intergenic
983027487 4:162755944-162755966 CAGTTTTTGACCACTCAGAGAGG - Intergenic
983185154 4:164692227-164692249 CAGTTTTTGACCACTCAGAGAGG - Intergenic
983530019 4:168801068-168801090 CAGTTATGCATCTCTGAGCAAGG - Intronic
984211524 4:176855003-176855025 TAGCTTTTCACCAATGAACAAGG - Intergenic
987305082 5:16629910-16629932 CATTGTGACACCACTGAGCAGGG + Intergenic
987578252 5:19757656-19757678 CAGTTTTTGACCACTCAGAGAGG + Intronic
987657058 5:20820996-20821018 CAGTTTTTGACCACTCAGAGAGG + Intergenic
987885533 5:23807154-23807176 CAGTTTTTGACCACTCAGAGAGG - Intergenic
988079741 5:26400773-26400795 CAGTTTTTTACCACTCAGGGAGG + Intergenic
988153655 5:27420583-27420605 CAGTTTTTCTCCATTCAGTATGG + Intergenic
988160740 5:27516216-27516238 CAGTTTTTGACCACTCAGAGAGG + Intergenic
988228841 5:28448778-28448800 CAGTTTTTTACCACTCAGAGAGG - Intergenic
988562219 5:32291491-32291513 CAGTTTTTGACCACTCAGAGAGG - Intronic
988766493 5:34382952-34382974 CAGTTTTTGACCACTCAGAGAGG - Intergenic
988820915 5:34884305-34884327 CAGTTTTTCACCATTAAGTATGG - Intronic
989097923 5:37797978-37798000 CAGTTTTTGACCACTCAGAGAGG - Intergenic
989457559 5:41661114-41661136 CAGTTTTTGACCACTCACAAAGG + Intergenic
989486293 5:41995707-41995729 CAGTTTTTGACCACTCAGAGAGG + Intergenic
989553605 5:42764815-42764837 CAGTTTTTCCCCATTCAGTATGG - Intronic
991286744 5:64985846-64985868 CAGTCTTTCACCATTAAGTATGG + Intronic
992243042 5:74790506-74790528 CATTTTTTCACCACTCAGAGAGG - Intronic
992307540 5:75458692-75458714 CAGGTGCTCACCACTAAGCACGG + Intronic
992406719 5:76465447-76465469 CTGTATTTCACCACTGAGTATGG - Intronic
993319909 5:86459232-86459254 CAGTTTTTGACCACTCAGAAAGG - Intergenic
993334173 5:86636243-86636265 CAGTATTTCTGCACTGAGCTTGG + Intergenic
993447880 5:88037078-88037100 CAGTGTTTTACCACTTAGAAAGG + Intergenic
993791867 5:92219562-92219584 CAGTTTTTGACCACTCAGAAAGG - Intergenic
994753770 5:103769934-103769956 TACTTTTTCACTAATGAGCAGGG - Intergenic
994855346 5:105112938-105112960 CAGTTTTTGACCACTCAGAGGGG + Intergenic
995051978 5:107717068-107717090 CAGTTTTTCACCCCTTAGGTGGG - Intergenic
995705828 5:114988812-114988834 CAGAGTTTCACCATTCAGCAAGG + Intergenic
995776195 5:115727044-115727066 CAGTTTTTGACCACTCAGAGAGG + Intergenic
996018648 5:118568514-118568536 CAGTTTTTGACCACTCAGAGGGG - Intergenic
996164874 5:120211863-120211885 TGGTTTTTGACCACTCAGCAAGG + Intergenic
996206052 5:120737213-120737235 CAGTCTTTCGCCATTGAGTATGG + Intergenic
998290246 5:140907900-140907922 CAGTTTTTGACCACTCAGAGAGG + Intronic
999351459 5:150875488-150875510 CAGTTTTTGACCACTCAGAGAGG - Intronic
1000526464 5:162364613-162364635 CAGTGTTTTACCATTGAACACGG - Intergenic
1001189649 5:169617208-169617230 AAGTTTCTCACCATTAAGCATGG - Intergenic
1001435982 5:171699738-171699760 CAGTTGTTCTCAACTGGGCATGG - Intergenic
1001552491 5:172613454-172613476 CAACTTTTCACCATTGAGTATGG - Intergenic
1001622221 5:173096662-173096684 CAGGTTTTCATCACTGAGTATGG + Intronic
1002651112 5:180695363-180695385 CAGTCTTTCACCACTGAGTATGG - Intergenic
1002892173 6:1344381-1344403 TAGTTTTTCACTATTAAGCATGG - Intergenic
1003648548 6:7937028-7937050 CTGTGTTTAAACACTGAGCAAGG - Intronic
1004604690 6:17183016-17183038 TAGTTTTTAATCCCTGAGCAAGG - Intergenic
1004824203 6:19402579-19402601 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1006001639 6:30969727-30969749 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1006295274 6:33167415-33167437 CAGTGACTCACCACTGAGCCTGG + Exonic
1006585091 6:35104676-35104698 TTCTTTTTCACCACTGGGCATGG - Intergenic
1007233559 6:40371244-40371266 TAGTTTTTCACCATTGAGTATGG + Intergenic
1008103393 6:47416760-47416782 TAGTTTTCCACCCTTGAGCAAGG + Intergenic
1008400373 6:51056119-51056141 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1009660600 6:66606276-66606298 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1010029404 6:71257531-71257553 CAGTTTTGCAGCACTCAGCAGGG + Intergenic
1010938154 6:81885768-81885790 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1011039258 6:83012635-83012657 CAGTTTTTGACCACTCAGAGAGG + Intronic
1011163380 6:84418441-84418463 CAGTTTTATGCCACTCAGCATGG + Intergenic
1011230162 6:85151719-85151741 CAGTTTTTCACCATTGAGTATGG + Intergenic
1012002041 6:93665578-93665600 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1012920696 6:105218887-105218909 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1013600033 6:111695076-111695098 CAGTTTTGGACCACTCAGCTGGG - Intronic
1014325046 6:119983579-119983601 CAGTTTTTCACTATTGTGTATGG + Intergenic
1014534100 6:122595950-122595972 CAGTTTTTGACCACTCAGAGAGG + Intronic
1014990304 6:128067156-128067178 AAGTGTGCCACCACTGAGCAAGG + Intronic
1015095357 6:129408946-129408968 CAGTTTTTGACCACTCAGAGAGG + Intronic
1015632194 6:135243028-135243050 CAATTGTACACCACTGAGCATGG - Intergenic
1016147238 6:140692060-140692082 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1016419526 6:143870016-143870038 CAGTTTTTGACCACTCAGAGAGG + Intronic
1016423110 6:143905654-143905676 CAGTCTTTCAGCATTGAGTATGG + Intronic
1017227715 6:152040434-152040456 CAGTTTTTGACCACTCAGAGAGG + Intronic
1017976952 6:159366498-159366520 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1018075994 6:160214228-160214250 CAGTTTTTGAGCTCTGAGAATGG - Intronic
1018534939 6:164809846-164809868 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1019635182 7:2071655-2071677 GAGTGGTTCACCAATGAGCAGGG + Intronic
1019897122 7:3991230-3991252 CAGTTGTTTCCCACTGAGCCTGG - Intronic
1021243975 7:18239183-18239205 CAGTTTTTCTCCAGTGTGCCAGG - Intronic
1022078975 7:27000984-27001006 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1022599910 7:31748011-31748033 CAGTTTTTGGTCCCTGAGCAAGG + Intergenic
1022633547 7:32109331-32109353 CAGATGTTTATCACTGAGCAAGG + Intronic
1023489141 7:40719380-40719402 CAGCTTTCCACCCCTGACCATGG + Intronic
1023901634 7:44485724-44485746 CTGTTTTTCACCACACTGCATGG + Intronic
1024040629 7:45550800-45550822 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1024346824 7:48322050-48322072 CAGTTTTTACCCACTGGGGATGG - Intronic
1024744299 7:52389077-52389099 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1024782096 7:52863230-52863252 CAATTTATCACCTCTGAGCCAGG - Intergenic
1024866188 7:53906999-53907021 CAGTTTTTGACCACTTAGAGAGG - Intergenic
1027406970 7:77872339-77872361 CAGTTTTTGACCACTCAGAGAGG + Intronic
1027685890 7:81278610-81278632 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1028043935 7:86092120-86092142 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1028141823 7:87282637-87282659 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1028237915 7:88383476-88383498 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1029961340 7:104691702-104691724 CAGTTTTTGACCACTCAGAGAGG - Intronic
1030368841 7:108674682-108674704 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1030421115 7:109307665-109307687 CAGTTTCTCACCATTAAGTAGGG + Intergenic
1030457375 7:109792397-109792419 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1030530311 7:110704223-110704245 CGATTTTTCCCCACTGTGCATGG - Intronic
1030883194 7:114905894-114905916 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1030931197 7:115525029-115525051 CAGTTTTTCACCACTTATAGAGG + Intergenic
1031236916 7:119188678-119188700 CAGTTTTTGACCACTCAGTTAGG - Intergenic
1031819346 7:126480105-126480127 CAGGTGTGCACCACTGAGCCTGG - Intronic
1032287528 7:130552519-130552541 GAGTTTATCTCCACTGAACATGG - Intronic
1032923394 7:136575475-136575497 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1034169897 7:149054927-149054949 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1034203573 7:149297055-149297077 CTATATTTCACCACTGATCATGG - Intronic
1034209136 7:149347476-149347498 CAGCCTTTCACCATTGAGTATGG - Intergenic
1034363802 7:150527178-150527200 CAGCTTTTCAACATTGAGTATGG + Intergenic
1035308313 7:157947855-157947877 CAGTTTTTCACCAGAAACCATGG + Intronic
1036381126 8:8237254-8237276 CAGCTGTTCACCACCGAGCTAGG + Intergenic
1036383569 8:8257773-8257795 CAGTCTTTCACCATTAAGTAGGG + Intergenic
1036848440 8:12185375-12185397 CAGCTGTTCACCACCGAGCTAGG - Exonic
1036869800 8:12427656-12427678 CAGCTGTTCACCACCGAGCTAGG - Exonic
1038829320 8:31039650-31039672 CAGTCTTTCACCATTAAGTATGG + Intronic
1039322344 8:36446020-36446042 TAGTTTTTCATTCCTGAGCAAGG + Intergenic
1040659017 8:49547175-49547197 CTGTTTTTCAAAACTGATCAAGG + Intronic
1041934635 8:63321984-63322006 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1042958310 8:74275775-74275797 CAGTTTTTCTTCACAGAACAAGG + Intronic
1044202479 8:89453142-89453164 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1044633061 8:94297750-94297772 CAGTTTTTGACCACTTAGAGAGG + Intergenic
1047099279 8:121658261-121658283 CAGTTTTTCACCTGTAAGTATGG + Intergenic
1047436735 8:124840927-124840949 CATTTTTTCAACAATGAACATGG - Intergenic
1051499540 9:17762186-17762208 CAGTTTCTAACCACAGGGCACGG + Intronic
1052039242 9:23719505-23719527 CATTTTTGCAACTCTGAGCAGGG + Intronic
1052227672 9:26109024-26109046 CAGTTTTTGACCACTCAGAGAGG - Intronic
1052258399 9:26486270-26486292 CAGTTTTTCCCCATTCAGTATGG + Intergenic
1052368738 9:27641489-27641511 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1052561476 9:30089336-30089358 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1053031980 9:34788178-34788200 CAGGTGTGCACCACTGAGCCTGG + Intergenic
1053520953 9:38779338-38779360 CAGGTTTTCATCATTGAGTATGG - Intergenic
1053695868 9:40638850-40638872 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1053942855 9:43269887-43269909 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1054193109 9:62003331-62003353 CAGGTTTTCATCATTGAGTATGG - Intergenic
1054307115 9:63438068-63438090 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1054405846 9:64762059-64762081 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1054439473 9:65247546-65247568 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1054490934 9:65774393-65774415 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1054645298 9:67585360-67585382 CAGGTTTTCATCATTGAGTATGG + Intergenic
1055649656 9:78394996-78395018 TAGTTTTTGATCTCTGAGCAAGG - Intergenic
1055674421 9:78640873-78640895 CACTTTGTCAACACTGTGCAGGG - Intergenic
1057970697 9:99554708-99554730 GAGTTATTCACCAGGGAGCAAGG + Intergenic
1058259173 9:102809032-102809054 CAGTTTTTGACCACGCAGAAAGG + Intergenic
1058525786 9:105856689-105856711 CAGTTTTCCACAACTGACCTTGG - Intergenic
1058917855 9:109584829-109584851 GACTCTTTCACCACTAAGCATGG + Intergenic
1060901322 9:127260660-127260682 CAGTTCATAACCACTGGGCATGG + Intronic
1061349027 9:130049244-130049266 CAGTTGTGCACCACTGTGCTTGG - Intergenic
1062135565 9:134925660-134925682 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1202778313 9_KI270717v1_random:12462-12484 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1186469680 X:9811482-9811504 CAGTTTTTGACCACTCAGAGAGG + Intronic
1187524009 X:20037780-20037802 CAGTTTTTGACCACTCAGAGAGG - Intronic
1188045239 X:25418503-25418525 CAGTTTTTCCTCATTCAGCATGG + Intergenic
1188814100 X:34689713-34689735 CAGTTTTTCCCCATTCAGTATGG + Intergenic
1189154795 X:38746081-38746103 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1189493326 X:41486955-41486977 CAGTCTTTCACCAGTAAGTATGG - Intergenic
1191008545 X:55737532-55737554 CAGTTTTTCACCACTGAGCATGG + Intronic
1191095622 X:56670517-56670539 CAGTTTTTGACCACTCAGACAGG + Intergenic
1191932996 X:66394816-66394838 CAGTTTTTGACCACTCAGGGAGG - Intergenic
1191946436 X:66539671-66539693 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1192201176 X:69067719-69067741 CAGATTTGCACCACTGCCCAAGG + Intergenic
1192540756 X:71969870-71969892 CTGTTTTTCACCATTAAGTATGG + Intergenic
1192635361 X:72810844-72810866 CAGTATTTCACCATTAGGCATGG + Intronic
1192646353 X:72909959-72909981 CAGTATTTCACCATTAGGCATGG - Intronic
1192661484 X:73047129-73047151 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1193053578 X:77126418-77126440 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1193073882 X:77334593-77334615 CAGTGTTTCAGCTCTGAGAATGG + Intergenic
1193151190 X:78126165-78126187 CACTGTTTCACTACTCAGCATGG + Exonic
1193216654 X:78872464-78872486 CTGTTTTACACCTCTGTGCAAGG + Intergenic
1193356338 X:80523775-80523797 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1193723281 X:85012443-85012465 CAGTTTTTCCCCATTTAGTATGG + Intronic
1193833039 X:86310757-86310779 CAGTTTTTGACCACTGAGAGAGG - Intronic
1193996375 X:88369950-88369972 CTGTTTTTCACTGCTAAGCATGG - Intergenic
1194454025 X:94080190-94080212 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1194485200 X:94477976-94477998 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1194513331 X:94821599-94821621 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1194877218 X:99204032-99204054 CAGTTTTTCACCATGCAGTATGG + Intergenic
1194899870 X:99497342-99497364 CTGCTTCTCCCCACTGAGCAGGG + Intergenic
1195197702 X:102516158-102516180 CAGTTTTCCAGCTCTGAGCTTGG - Intronic
1195683436 X:107565309-107565331 CAGTTCTTCAGCACAGGGCAGGG + Intronic
1195748845 X:108144711-108144733 CAGTTTTTGACCACTCAGAGAGG + Intronic
1195782265 X:108479213-108479235 CAGTTTTTGACCACTCAGAGAGG + Intronic
1196135875 X:112209189-112209211 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1196320451 X:114334321-114334343 CATGTTTTCACCATTGAGAAAGG + Intergenic
1197182181 X:123548432-123548454 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1197380397 X:125731398-125731420 CAGTTTTTCCCCATTCAGTATGG + Intergenic
1197591958 X:128420036-128420058 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1198782958 X:140257160-140257182 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1198934130 X:141888507-141888529 CAGTTTTTGACCACTCAGAAAGG - Intronic
1199116490 X:143998609-143998631 CAATTTTTGACCACTCAGCAAGG + Intergenic
1199179597 X:144838105-144838127 TATTTTTTCACCACTGAATAAGG + Intergenic
1199310348 X:146313749-146313771 CAGTTTTTGACCACTCAGGGAGG + Intergenic
1199783820 X:151085977-151085999 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1200521353 Y:4212678-4212700 CAGTTTTTGACCACTCAGAAAGG - Intergenic
1201184725 Y:11389199-11389221 CAGTTTTTCCCAACTGAGCTTGG - Intergenic
1201529575 Y:14977257-14977279 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1201798497 Y:17927319-17927341 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1201803056 Y:17978638-17978660 CAGTTTTTGACCACTCAGAGAGG + Intergenic
1202359818 Y:24096009-24096031 CAGTTTTTGACCACTCAGAGAGG - Intergenic
1202510960 Y:25574105-25574127 CAGTTTTTGACCACTCAGAGAGG + Intergenic