ID: 1191016254

View in Genome Browser
Species Human (GRCh38)
Location X:55813395-55813417
Sequence TGGGTATCCCTGCACTCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191016245_1191016254 26 Left 1191016245 X:55813346-55813368 CCCTGTATTCCCAGGCATAGCTG No data
Right 1191016254 X:55813395-55813417 TGGGTATCCCTGCACTCTCAGGG No data
1191016247_1191016254 17 Left 1191016247 X:55813355-55813377 CCCAGGCATAGCTGCAACTGCCC No data
Right 1191016254 X:55813395-55813417 TGGGTATCCCTGCACTCTCAGGG No data
1191016246_1191016254 25 Left 1191016246 X:55813347-55813369 CCTGTATTCCCAGGCATAGCTGC No data
Right 1191016254 X:55813395-55813417 TGGGTATCCCTGCACTCTCAGGG No data
1191016248_1191016254 16 Left 1191016248 X:55813356-55813378 CCAGGCATAGCTGCAACTGCCCA No data
Right 1191016254 X:55813395-55813417 TGGGTATCCCTGCACTCTCAGGG No data
1191016249_1191016254 -3 Left 1191016249 X:55813375-55813397 CCCAGCTGCAGCTCGAGATCTGG No data
Right 1191016254 X:55813395-55813417 TGGGTATCCCTGCACTCTCAGGG No data
1191016251_1191016254 -4 Left 1191016251 X:55813376-55813398 CCAGCTGCAGCTCGAGATCTGGG No data
Right 1191016254 X:55813395-55813417 TGGGTATCCCTGCACTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191016254 Original CRISPR TGGGTATCCCTGCACTCTCA GGG Intergenic
No off target data available for this crispr