ID: 1191019305

View in Genome Browser
Species Human (GRCh38)
Location X:55842532-55842554
Sequence AGGGTGGCTGCACTGTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191019296_1191019305 10 Left 1191019296 X:55842499-55842521 CCCATGTAAAAAACAGTCTGGCC No data
Right 1191019305 X:55842532-55842554 AGGGTGGCTGCACTGTGCTGGGG No data
1191019297_1191019305 9 Left 1191019297 X:55842500-55842522 CCATGTAAAAAACAGTCTGGCCA No data
Right 1191019305 X:55842532-55842554 AGGGTGGCTGCACTGTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191019305 Original CRISPR AGGGTGGCTGCACTGTGCTG GGG Intergenic
No off target data available for this crispr