ID: 1191022513

View in Genome Browser
Species Human (GRCh38)
Location X:55877815-55877837
Sequence TGCTGTGGCTTGCACAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191022505_1191022513 25 Left 1191022505 X:55877767-55877789 CCATGCTGCTGTGGCTGGATGGC No data
Right 1191022513 X:55877815-55877837 TGCTGTGGCTTGCACAACACTGG No data
1191022510_1191022513 -7 Left 1191022510 X:55877799-55877821 CCAGAAGCCTGGGGTTTGCTGTG No data
Right 1191022513 X:55877815-55877837 TGCTGTGGCTTGCACAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191022513 Original CRISPR TGCTGTGGCTTGCACAACAC TGG Intergenic
No off target data available for this crispr