ID: 1191024812 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:55902463-55902485 |
| Sequence | CTCAATATAAAAATGGGCAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 4383 | |||
| Summary | {0: 3, 1: 29, 2: 257, 3: 904, 4: 3190} |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1191024812_1191024816 | 6 | Left | 1191024812 | X:55902463-55902485 | CCTTTGCCCATTTTTATATTGAG | 0: 3 1: 29 2: 257 3: 904 4: 3190 |
||
| Right | 1191024816 | X:55902492-55902514 | TTTGTTGCTGTTGGTGTTTTAGG | No data | ||||
| 1191024812_1191024817 | 7 | Left | 1191024812 | X:55902463-55902485 | CCTTTGCCCATTTTTATATTGAG | 0: 3 1: 29 2: 257 3: 904 4: 3190 |
||
| Right | 1191024817 | X:55902493-55902515 | TTGTTGCTGTTGGTGTTTTAGGG | No data | ||||
| 1191024812_1191024815 | -3 | Left | 1191024812 | X:55902463-55902485 | CCTTTGCCCATTTTTATATTGAG | 0: 3 1: 29 2: 257 3: 904 4: 3190 |
||
| Right | 1191024815 | X:55902483-55902505 | GAGTTGCTTTTTGTTGCTGTTGG | No data | ||||
| 1191024812_1191024818 | 8 | Left | 1191024812 | X:55902463-55902485 | CCTTTGCCCATTTTTATATTGAG | 0: 3 1: 29 2: 257 3: 904 4: 3190 |
||
| Right | 1191024818 | X:55902494-55902516 | TGTTGCTGTTGGTGTTTTAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1191024812 | Original CRISPR | CTCAATATAAAAATGGGCAA AGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||