ID: 1191024812

View in Genome Browser
Species Human (GRCh38)
Location X:55902463-55902485
Sequence CTCAATATAAAAATGGGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4383
Summary {0: 3, 1: 29, 2: 257, 3: 904, 4: 3190}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191024812_1191024816 6 Left 1191024812 X:55902463-55902485 CCTTTGCCCATTTTTATATTGAG 0: 3
1: 29
2: 257
3: 904
4: 3190
Right 1191024816 X:55902492-55902514 TTTGTTGCTGTTGGTGTTTTAGG No data
1191024812_1191024817 7 Left 1191024812 X:55902463-55902485 CCTTTGCCCATTTTTATATTGAG 0: 3
1: 29
2: 257
3: 904
4: 3190
Right 1191024817 X:55902493-55902515 TTGTTGCTGTTGGTGTTTTAGGG No data
1191024812_1191024815 -3 Left 1191024812 X:55902463-55902485 CCTTTGCCCATTTTTATATTGAG 0: 3
1: 29
2: 257
3: 904
4: 3190
Right 1191024815 X:55902483-55902505 GAGTTGCTTTTTGTTGCTGTTGG No data
1191024812_1191024818 8 Left 1191024812 X:55902463-55902485 CCTTTGCCCATTTTTATATTGAG 0: 3
1: 29
2: 257
3: 904
4: 3190
Right 1191024818 X:55902494-55902516 TGTTGCTGTTGGTGTTTTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191024812 Original CRISPR CTCAATATAAAAATGGGCAA AGG (reversed) Intergenic
Too many off-targets to display for this crispr