ID: 1191026762

View in Genome Browser
Species Human (GRCh38)
Location X:55922302-55922324
Sequence TGTCCTTTGTAGGACATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191026759_1191026762 -2 Left 1191026759 X:55922281-55922303 CCATAAAAAGGAATGAGATCTTG 0: 16
1: 1232
2: 3225
3: 7282
4: 16844
Right 1191026762 X:55922302-55922324 TGTCCTTTGTAGGACATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191026762 Original CRISPR TGTCCTTTGTAGGACATGGA TGG Intergenic
No off target data available for this crispr