ID: 1191026762 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:55922302-55922324 |
| Sequence | TGTCCTTTGTAGGACATGGA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1191026759_1191026762 | -2 | Left | 1191026759 | X:55922281-55922303 | CCATAAAAAGGAATGAGATCTTG | 0: 16 1: 1232 2: 3225 3: 7282 4: 16844 |
||
| Right | 1191026762 | X:55922302-55922324 | TGTCCTTTGTAGGACATGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1191026762 | Original CRISPR | TGTCCTTTGTAGGACATGGA TGG | Intergenic | ||
| No off target data available for this crispr | |||||