ID: 1191030224

View in Genome Browser
Species Human (GRCh38)
Location X:55961575-55961597
Sequence TGGTATGCACAGTGAATAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191030224 Original CRISPR TGGTATGCACAGTGAATAAC TGG (reversed) Intergenic
906453095 1:45969553-45969575 TTGTATGCACAGTTCACAACAGG - Intronic
908062909 1:60371324-60371346 TGATATGCACAGTGAAATACAGG + Intergenic
910273337 1:85420636-85420658 TGGTATGCACAGTGAAGTCCAGG - Intronic
911494673 1:98616563-98616585 TGGCATGCACAGTGCACAATCGG - Intergenic
911888712 1:103339325-103339347 TGGTAAGCTGAGTGAATCACAGG - Intergenic
912006275 1:104904711-104904733 TGGTATGGACAGTGAAGTCCAGG - Intergenic
917025131 1:170633208-170633230 AGGTTTTCACAGTGAATATCTGG - Intergenic
917258523 1:173141977-173141999 TGGTCTGCACAGTGACAAACTGG + Intergenic
922187955 1:223293095-223293117 TGGCATGAACAGTGAATGGCTGG + Intronic
923891890 1:238224999-238225021 TTGTATGCACAGTTCACAACAGG + Intergenic
924936509 1:248776665-248776687 TGATATGAACAGTGAAGACCAGG + Intergenic
924936862 1:248779128-248779150 TGATATGCACAATGAAGACCAGG - Intergenic
1064685148 10:17853841-17853863 TGGTAAACACAGTGATTAAGAGG + Intronic
1065062631 10:21921165-21921187 TGGTATCCACAGTATATTACTGG - Intronic
1069188999 10:65464290-65464312 TCTTATGTACAGTGAATATCTGG + Intergenic
1069754542 10:70765436-70765458 TGATATGGACAGTGAATTCCAGG + Intergenic
1069804938 10:71116149-71116171 TGGTATGGACAGTGAAGTCCAGG + Intergenic
1071177482 10:82943262-82943284 TGGTAAGGACAATGAATAAGAGG + Intronic
1071221603 10:83473586-83473608 TGTTATGCACTTTGAAAAACAGG + Intergenic
1071364307 10:84883255-84883277 TGGTAAGCCCAGTGAATTCCAGG + Intergenic
1071381291 10:85062976-85062998 TGGAAAGCAGAGTGAATGACAGG - Intergenic
1071390761 10:85172973-85172995 TGTTATGAAGAGTGAATAAAAGG + Intergenic
1071968091 10:90873128-90873150 TGTTAAGCACAGTAAATAAAAGG - Intronic
1075604874 10:123797437-123797459 TGGGAAGCACAGTGAACAATCGG - Intronic
1077399809 11:2349013-2349035 TGATATGGACAGTGAAGGACAGG + Intergenic
1078005487 11:7529454-7529476 TGGTGTCCACTGAGAATAACCGG + Intronic
1079306290 11:19326459-19326481 TGTTATGCAGAATGAATTACAGG + Intergenic
1079972921 11:27058568-27058590 TGATATGGACAGTGAATGCCTGG + Intronic
1080242892 11:30147358-30147380 TCGCATGCACAGTTCATAACAGG + Intergenic
1080957848 11:37121808-37121830 TTATATGCACAGTGAATTTCTGG + Intergenic
1084198291 11:67538915-67538937 TGGTGGACACAGTGAATGACGGG + Intergenic
1085599120 11:77838925-77838947 TGGTAAGCACAGTAAGTAAAAGG - Intronic
1087334811 11:96830178-96830200 TGGTATGCACAGTGATCACATGG - Intergenic
1088012930 11:105024906-105024928 TGGTGTGCACAGTGAAGTCCTGG - Intergenic
1092563621 12:9642091-9642113 TGGTCTGCACAATGACAAACCGG - Intergenic
1093228412 12:16513753-16513775 TGGTCTGCACAGTGACAAACCGG - Intronic
1093673791 12:21909583-21909605 TGGTAGGAACAGTGACAAACTGG - Intronic
1097707952 12:62887681-62887703 TGGTATGCACAGGGAAGACAAGG + Intronic
1097832273 12:64238263-64238285 TGCTCTGCACAGTACATAACAGG + Intergenic
1099552589 12:84066794-84066816 TGGTATTCACAGTGAACGTCTGG + Intergenic
1100078347 12:90816596-90816618 TCGTATGCACAGTGAATGTGTGG - Intergenic
1101148239 12:101861967-101861989 TGGTATGCACAGTTCACAATAGG - Intergenic
1101429705 12:104616790-104616812 TGGTCTGCACAATCATTAACTGG + Intronic
1101553264 12:105783399-105783421 TGATTTGCACAGTGAAGAAGGGG - Intergenic
1103860408 12:124007902-124007924 AGAGATGCACAGTGAAGAACAGG - Intronic
1107933946 13:45329179-45329201 TGGTATGCAAAGTGAGAAAAAGG + Intergenic
1108154506 13:47571978-47572000 TGATATGGACAATGAAGAACAGG + Intergenic
1110140598 13:72123956-72123978 TGTTATGCACAGTAGATAACTGG + Intergenic
1110239918 13:73255895-73255917 TGGGGTGCACAGTGCATAAAAGG - Intergenic
1115121294 14:29941116-29941138 TGATATGGACAGTGAAGACCAGG + Intronic
1117073428 14:52076702-52076724 TTGCATGCACAGTGCTTAACCGG - Intergenic
1119325562 14:73758184-73758206 TGCTCTGGACAGTGAATAATAGG - Intronic
1130518755 15:84646058-84646080 GGGGATACACAGTGAATAAGAGG - Intronic
1134100253 16:11446912-11446934 TGGTGTGCAGAGGGAAAAACAGG + Intronic
1149297545 17:55274035-55274057 TGGTAGGCACAGTGCTGAACTGG - Intronic
1149395116 17:56232629-56232651 TGGTAGAGACAGTGAATATCTGG + Intronic
1150071553 17:62154982-62155004 TGGAATGCAAAGTTTATAACTGG - Intergenic
1153971417 18:10230403-10230425 TGTTATGCAGAATGGATAACTGG + Intergenic
1167846877 19:52171737-52171759 TGGAAGGCAGAGCGAATAACAGG - Intergenic
927988950 2:27433691-27433713 AGGTATGCACTGTCAATACCTGG - Exonic
929195939 2:39184208-39184230 TGGTATACACAATGTATGACAGG + Intronic
930616015 2:53594496-53594518 TGGAAAGGACAGTGTATAACTGG + Intronic
930758917 2:55010147-55010169 TGGTATGCATAATTAATAATTGG - Intronic
932531483 2:72538399-72538421 TGGTAACCACAGTAAAAAACAGG + Intronic
933211049 2:79569218-79569240 GTGAATGCACAGTGAATGACAGG + Intronic
933560944 2:83885370-83885392 TGGTATTTACAGTGAAACACAGG + Intergenic
937656716 2:124385307-124385329 TGGATGGCACAGTGAATAATAGG - Intronic
937815518 2:126246503-126246525 ACATATGTACAGTGAATAACTGG - Intergenic
937892339 2:126948285-126948307 TGGTATGCACAGGGAATGAGGGG - Intergenic
938427320 2:131202661-131202683 TGGTATGCACCCTGAAGCACAGG - Intronic
940344296 2:152613389-152613411 TGAGATTCACAATGAATAACAGG - Intronic
940917403 2:159271959-159271981 TGGGATGCAGTGTGATTAACTGG + Intronic
941277660 2:163510691-163510713 TGGAATGTGCACTGAATAACAGG + Intergenic
942596459 2:177595657-177595679 TGGAAAGCACAGTGATTAAAGGG - Intergenic
943002464 2:182345624-182345646 TGGTATGTTCAATGAATAGCAGG - Intronic
946083082 2:217142958-217142980 TGGTAAGAACAGTGAATTTCTGG - Intergenic
946101990 2:217333265-217333287 TTGTAGGCACAGGGAATAGCAGG + Intronic
948162266 2:235834641-235834663 TGGTCTGCTAAGTGAACAACTGG - Intronic
1176613354 21:9007119-9007141 TGGTATGGACAGTGAAGGATAGG + Intergenic
1179398922 21:41066294-41066316 TTGGATGCACAGGGGATAACAGG - Intergenic
1180321286 22:11323717-11323739 TGGTATAAACAGTGCATTACGGG - Intergenic
1182817685 22:33180490-33180512 TGCTAGGCACTGTGAAAAACTGG + Intronic
1183847313 22:40552959-40552981 TGGTATGGACAATGAAGTACAGG + Intronic
949247348 3:1940812-1940834 TGATATGCTCAGTGAAGAAATGG - Intergenic
949255141 3:2036808-2036830 TGCTGTGCACAGAGAATAAAAGG - Intergenic
952210303 3:31223395-31223417 TCGCATGCACAGTGCACAACAGG + Intergenic
952707044 3:36389788-36389810 TGGAAAGCACAGTGAATCTCTGG - Intronic
956552048 3:70472233-70472255 TGGTATGCACAGTTCACAATAGG - Intergenic
958685503 3:97387564-97387586 TGATATGTACAGTGAAAAGCAGG - Intronic
959051008 3:101525220-101525242 TGATATGGACAGTGAAGACCAGG + Intergenic
960600139 3:119449033-119449055 TGCTATGGAAAGTAAATAACAGG + Intronic
960921785 3:122754483-122754505 GGGAATGCAGAGTGACTAACAGG + Intronic
963527427 3:146431612-146431634 TGGAAAGAACAGTGAATTACAGG + Intronic
965290435 3:166872227-166872249 TGATATGGACAGTGAAGACCAGG + Intergenic
965301645 3:167012131-167012153 TGATATGCACAGTGAAATCCAGG - Intergenic
966401900 3:179556041-179556063 TGGTACGAACAGTAAATCACAGG + Intergenic
966447028 3:180012203-180012225 TGAGATGAACAGTGAAGAACAGG + Intronic
966550649 3:181200580-181200602 TGATATGGACAGTGAAGGACAGG - Intergenic
967580208 3:191144198-191144220 TGGTCTGAACAGTGAATCAAAGG + Intergenic
971067465 4:23049986-23050008 TGGTATGGAAAGTGAATAGTGGG + Intergenic
974245515 4:59310813-59310835 TGGTAGGCACTGTTAATTACTGG - Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
979448065 4:120838670-120838692 TGGCATGCACAGTTTACAACAGG + Intronic
981780832 4:148427412-148427434 AGGTATCCACAGTGAAGAAAGGG + Intronic
983812244 4:172077364-172077386 TGATATGGACAGTGAAGTACAGG + Intronic
986597307 5:9437114-9437136 TGGTATGCACTGCAAATAAGTGG + Intronic
987041615 5:14068316-14068338 TGGAATGCACAGTAAATGACTGG + Intergenic
987142036 5:14956548-14956570 GGATATGCACTGTGAATACCTGG - Intergenic
987727206 5:21717693-21717715 TGATATGAACAGTGAAGTACAGG - Intergenic
989139163 5:38185376-38185398 TGGTGTGGATATTGAATAACAGG + Intergenic
990245271 5:53858075-53858097 TTGTATGCACAGTTCATAATAGG + Intergenic
990518358 5:56552185-56552207 TGGTAAGCACAGTGTAGACCCGG + Intronic
990939481 5:61187530-61187552 TGTTATGGACAGTGAATTCCAGG + Intergenic
990975275 5:61555208-61555230 TGATATGGACAGTGAATTCCAGG - Intergenic
995043176 5:107612666-107612688 TGCAATGCACAGTGAAGAACTGG + Intronic
996169893 5:120276626-120276648 TGGTAAGCAGTGTGAATAAAAGG + Intergenic
996394883 5:123003695-123003717 TGGCTTGGACAGTGAAGAACAGG + Intronic
996454015 5:123659129-123659151 AGGTTTGCACGGTGAATGACAGG + Intergenic
996525167 5:124471916-124471938 TGAGATGCAAAGTGAATTACAGG - Intergenic
997664177 5:135615306-135615328 TGATATGGACAGTGAACACCGGG + Intergenic
999860778 5:155643425-155643447 AGGTTTGCACTGTGGATAACTGG - Intergenic
1000027629 5:157373754-157373776 TGGTATGTGCAGAGAAGAACTGG + Intronic
1005067150 6:21829850-21829872 TGTTATGCACAGAGAATGAAAGG + Intergenic
1012036475 6:94147808-94147830 TGATTTACACAGTGAATAATTGG - Intergenic
1012078756 6:94728316-94728338 TGGTATGAACAGTGAAGTCCAGG - Intergenic
1013130057 6:107224008-107224030 TGGCATGCACAGTTCACAACGGG - Intronic
1014474669 6:121857812-121857834 TCGTATGCACAGTTTACAACAGG - Intergenic
1015732469 6:136362586-136362608 TGGCATTCACAGTGGATGACGGG + Exonic
1015854151 6:137605642-137605664 TGGGATGAACAGGGAATAGCAGG - Intergenic
1017587386 6:155942028-155942050 AAGTATGCACAGGGAACAACGGG - Intergenic
1018951842 6:168384303-168384325 GGGAATGCACAGTCAGTAACTGG - Intergenic
1022079061 7:27001574-27001596 TGGTAAGACCAGTGAATTACAGG - Intergenic
1023618305 7:42043461-42043483 TGGTATGATCAGTGAAGAACTGG - Intronic
1023634832 7:42199306-42199328 TAGTATGCAAGGTAAATAACAGG + Intronic
1023805622 7:43870769-43870791 TGTTATGCATATTGAATAAAGGG + Intronic
1026181511 7:68045184-68045206 TTGTATGCACAGTTCACAACAGG + Intergenic
1026272357 7:68847690-68847712 TGGATTGCACAGTTAATAAATGG + Intergenic
1031593635 7:123623160-123623182 TGTTATGCACTGTGGACAACAGG - Intronic
1031787906 7:126058233-126058255 TGGTATGGACAATGAAGTACAGG + Intergenic
1033956454 7:146854798-146854820 TGGCATGCACAGGGAATGACAGG + Intronic
1035209873 7:157319859-157319881 TGGTAGGGACAGTTTATAACAGG + Intergenic
1036066776 8:5389594-5389616 TGGTAGCAACAGTGAATTACAGG + Intergenic
1037447561 8:18981662-18981684 TTATATTCACAGTGAATCACTGG - Intronic
1039041201 8:33410382-33410404 TGGTATGCACTGCAAATAGCTGG + Intronic
1039148775 8:34479864-34479886 TGATATGCACAGTGAAGTTCAGG - Intergenic
1039168649 8:34715396-34715418 TGGTATGGACAGTGAATTCCTGG - Intergenic
1039318840 8:36405559-36405581 TGCTCTGCACAGTTAATACCTGG + Intergenic
1039706205 8:40010105-40010127 TGGTAAGCACAATGAAGAAATGG + Intronic
1041185798 8:55299682-55299704 TGGTATACAGAGTGAAGAACAGG + Intronic
1043384330 8:79733003-79733025 TGGTATGGACAGTGAAGTCCAGG - Intergenic
1043931477 8:86096261-86096283 TGGTGTGCACATTTAACAACTGG + Intronic
1045334001 8:101182000-101182022 TTGCATGCACAGTGCACAACAGG + Intronic
1047601425 8:126429629-126429651 TTGAGTGCACAGTGCATAACAGG + Intergenic
1047949429 8:129918114-129918136 TGGCATGCATAGTTAAAAACAGG - Intronic
1048944043 8:139428049-139428071 AGGTATACACAGTGAGTAACAGG - Intergenic
1051590186 9:18769820-18769842 TGGTATGCCCAGTGAAAAGCTGG + Intronic
1052542352 9:29827408-29827430 TGATATGGACAGTGAAGTACAGG + Intergenic
1057715483 9:97491864-97491886 TGGTACTCACAGTGAATATCAGG - Intronic
1058569357 9:106324173-106324195 TGGAATGCACAGTGAATGCAGGG + Intergenic
1059762064 9:117347392-117347414 TTGTATGCACAGTGAAGAGCTGG - Intronic
1191030224 X:55961575-55961597 TGGTATGCACAGTGAATAACTGG - Intergenic
1193672457 X:84404837-84404859 TGGTATGCACTTTGCATAAGGGG - Intronic
1194461078 X:94168609-94168631 TGATATGGACAGTGAAGTACAGG + Intergenic
1194922335 X:99781315-99781337 TGATATGCACAGTGAAGTCCTGG - Intergenic
1195035007 X:100964501-100964523 TGATATGGACAGTGAAGTACAGG + Intergenic
1195465800 X:105177233-105177255 TGGCATGCACAGTTCACAACAGG - Intronic
1196129579 X:112140311-112140333 TGGTATGAAAAATGAATATCTGG + Intergenic
1197115879 X:122833208-122833230 TGGTATGTACAGTGATGTACTGG - Intergenic
1199045986 X:143173823-143173845 TTGTATGCAAATTAAATAACTGG + Intergenic
1199384484 X:147207978-147208000 TGATATGGACACTGAAGAACAGG + Intergenic
1201067852 Y:10116282-10116304 TGGTCTGGACAGTGAATGCCGGG + Intergenic