ID: 1191030627

View in Genome Browser
Species Human (GRCh38)
Location X:55966102-55966124
Sequence GTTTTCTACTGCAGCTAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191030627_1191030628 -1 Left 1191030627 X:55966102-55966124 CCAGCTTAGCTGCAGTAGAAAAC No data
Right 1191030628 X:55966124-55966146 CAGTACCAGTTAGATCTCTAAGG No data
1191030627_1191030631 30 Left 1191030627 X:55966102-55966124 CCAGCTTAGCTGCAGTAGAAAAC No data
Right 1191030631 X:55966155-55966177 TCCAGTCCCTGGTTCCCAGATGG No data
1191030627_1191030630 19 Left 1191030627 X:55966102-55966124 CCAGCTTAGCTGCAGTAGAAAAC No data
Right 1191030630 X:55966144-55966166 AGGTTTTTGACTCCAGTCCCTGG 0: 17
1: 76
2: 173
3: 294
4: 455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191030627 Original CRISPR GTTTTCTACTGCAGCTAAGC TGG (reversed) Intergenic
No off target data available for this crispr