ID: 1191031247

View in Genome Browser
Species Human (GRCh38)
Location X:55975264-55975286
Sequence CCAAATGCATTCTCTCTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191031247_1191031254 -2 Left 1191031247 X:55975264-55975286 CCCTGAAGAGAGAATGCATTTGG No data
Right 1191031254 X:55975285-55975307 GGCATGTTGGGAGGATTTAAGGG No data
1191031247_1191031255 12 Left 1191031247 X:55975264-55975286 CCCTGAAGAGAGAATGCATTTGG No data
Right 1191031255 X:55975299-55975321 ATTTAAGGGTAATGCAAATGTGG No data
1191031247_1191031253 -3 Left 1191031247 X:55975264-55975286 CCCTGAAGAGAGAATGCATTTGG No data
Right 1191031253 X:55975284-55975306 TGGCATGTTGGGAGGATTTAAGG No data
1191031247_1191031258 23 Left 1191031247 X:55975264-55975286 CCCTGAAGAGAGAATGCATTTGG No data
Right 1191031258 X:55975310-55975332 ATGCAAATGTGGTGAACAAGGGG No data
1191031247_1191031256 21 Left 1191031247 X:55975264-55975286 CCCTGAAGAGAGAATGCATTTGG No data
Right 1191031256 X:55975308-55975330 TAATGCAAATGTGGTGAACAAGG No data
1191031247_1191031257 22 Left 1191031247 X:55975264-55975286 CCCTGAAGAGAGAATGCATTTGG No data
Right 1191031257 X:55975309-55975331 AATGCAAATGTGGTGAACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191031247 Original CRISPR CCAAATGCATTCTCTCTTCA GGG (reversed) Intergenic
No off target data available for this crispr