ID: 1191031257

View in Genome Browser
Species Human (GRCh38)
Location X:55975309-55975331
Sequence AATGCAAATGTGGTGAACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191031247_1191031257 22 Left 1191031247 X:55975264-55975286 CCCTGAAGAGAGAATGCATTTGG No data
Right 1191031257 X:55975309-55975331 AATGCAAATGTGGTGAACAAGGG No data
1191031249_1191031257 21 Left 1191031249 X:55975265-55975287 CCTGAAGAGAGAATGCATTTGGC No data
Right 1191031257 X:55975309-55975331 AATGCAAATGTGGTGAACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191031257 Original CRISPR AATGCAAATGTGGTGAACAA GGG Intergenic
No off target data available for this crispr