ID: 1191033181

View in Genome Browser
Species Human (GRCh38)
Location X:55997255-55997277
Sequence CTGGCTAATGATGCTTCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191033181_1191033186 -4 Left 1191033181 X:55997255-55997277 CCTAGAGAAGCATCATTAGCCAG No data
Right 1191033186 X:55997274-55997296 CCAGTGCGGATGGGCATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191033181 Original CRISPR CTGGCTAATGATGCTTCTCT AGG (reversed) Intergenic
No off target data available for this crispr