ID: 1191033341

View in Genome Browser
Species Human (GRCh38)
Location X:55998368-55998390
Sequence ATATTTCAGACTATTACATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191033335_1191033341 -8 Left 1191033335 X:55998353-55998375 CCTTCCCACGAGGCCATATTTCA 0: 341
1: 217
2: 177
3: 56
4: 140
Right 1191033341 X:55998368-55998390 ATATTTCAGACTATTACATGGGG No data
1191033334_1191033341 -7 Left 1191033334 X:55998352-55998374 CCCTTCCCACGAGGCCATATTTC 0: 302
1: 230
2: 198
3: 85
4: 107
Right 1191033341 X:55998368-55998390 ATATTTCAGACTATTACATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191033341 Original CRISPR ATATTTCAGACTATTACATG GGG Intergenic
No off target data available for this crispr