ID: 1191034297

View in Genome Browser
Species Human (GRCh38)
Location X:56008374-56008396
Sequence GAGAATAAGGAAAAGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191034289_1191034297 23 Left 1191034289 X:56008328-56008350 CCAGGTTCTCTTGCTGGGACTGA No data
Right 1191034297 X:56008374-56008396 GAGAATAAGGAAAAGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191034297 Original CRISPR GAGAATAAGGAAAAGCAGGG TGG Intergenic
No off target data available for this crispr