ID: 1191043792

View in Genome Browser
Species Human (GRCh38)
Location X:56114111-56114133
Sequence CTGCTTCTATAGGTGGGACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191043792_1191043799 18 Left 1191043792 X:56114111-56114133 CCGGGTCCCACCTATAGAAGCAG No data
Right 1191043799 X:56114152-56114174 CAGCTGCTGTGCTACACTGTGGG No data
1191043792_1191043796 -8 Left 1191043792 X:56114111-56114133 CCGGGTCCCACCTATAGAAGCAG No data
Right 1191043796 X:56114126-56114148 AGAAGCAGTCTGTCCATGATTGG No data
1191043792_1191043798 17 Left 1191043792 X:56114111-56114133 CCGGGTCCCACCTATAGAAGCAG No data
Right 1191043798 X:56114151-56114173 ACAGCTGCTGTGCTACACTGTGG No data
1191043792_1191043800 19 Left 1191043792 X:56114111-56114133 CCGGGTCCCACCTATAGAAGCAG No data
Right 1191043800 X:56114153-56114175 AGCTGCTGTGCTACACTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191043792 Original CRISPR CTGCTTCTATAGGTGGGACC CGG (reversed) Intergenic
No off target data available for this crispr