ID: 1191054198

View in Genome Browser
Species Human (GRCh38)
Location X:56225402-56225424
Sequence CCAACTAATAGGTGGTAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191054190_1191054198 14 Left 1191054190 X:56225365-56225387 CCTGGCCTAGGGGTCTTTATTAT No data
Right 1191054198 X:56225402-56225424 CCAACTAATAGGTGGTAAGGGGG No data
1191054191_1191054198 9 Left 1191054191 X:56225370-56225392 CCTAGGGGTCTTTATTATTTTTC No data
Right 1191054198 X:56225402-56225424 CCAACTAATAGGTGGTAAGGGGG No data
1191054189_1191054198 15 Left 1191054189 X:56225364-56225386 CCCTGGCCTAGGGGTCTTTATTA No data
Right 1191054198 X:56225402-56225424 CCAACTAATAGGTGGTAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191054198 Original CRISPR CCAACTAATAGGTGGTAAGG GGG Intergenic
No off target data available for this crispr