ID: 1191054320

View in Genome Browser
Species Human (GRCh38)
Location X:56226850-56226872
Sequence ATCCTGTTATTGTGGCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191054314_1191054320 4 Left 1191054314 X:56226823-56226845 CCTGCTGGCCTGACTTGAGAAGG No data
Right 1191054320 X:56226850-56226872 ATCCTGTTATTGTGGCTCCAGGG No data
1191054313_1191054320 5 Left 1191054313 X:56226822-56226844 CCCTGCTGGCCTGACTTGAGAAG No data
Right 1191054320 X:56226850-56226872 ATCCTGTTATTGTGGCTCCAGGG No data
1191054317_1191054320 -4 Left 1191054317 X:56226831-56226853 CCTGACTTGAGAAGGGAATATCC No data
Right 1191054320 X:56226850-56226872 ATCCTGTTATTGTGGCTCCAGGG No data
1191054311_1191054320 26 Left 1191054311 X:56226801-56226823 CCTGGCTTACTCTTTTAAATACC No data
Right 1191054320 X:56226850-56226872 ATCCTGTTATTGTGGCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191054320 Original CRISPR ATCCTGTTATTGTGGCTCCA GGG Intergenic
No off target data available for this crispr