ID: 1191055119

View in Genome Browser
Species Human (GRCh38)
Location X:56232914-56232936
Sequence CTGAATTGGTAGAGGTAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 204}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191055119 Original CRISPR CTGAATTGGTAGAGGTAAAA GGG Intronic
901687188 1:10949461-10949483 CTGAATTTGAGGAGGTAACATGG + Intronic
905343625 1:37296387-37296409 CTGAATTTGTAGAAACAAAATGG + Intergenic
911131345 1:94391492-94391514 CTGGAATGGAAGAGGTCAAATGG - Intergenic
912892438 1:113548929-113548951 CTGGATGGGTAGAAGTGAAAAGG + Intronic
917315642 1:173722263-173722285 CTTAAATGGTTGAGGAAAAAAGG + Intronic
918990338 1:191690963-191690985 TTTGATTTGTAGAGGTAAAAGGG - Intergenic
919165794 1:193889726-193889748 GTAAGTTGGTAGAAGTAAAATGG + Intergenic
919520489 1:198582135-198582157 CTGCTCTGGTAGAGGTAACAGGG + Intergenic
919597117 1:199578046-199578068 CTGCTTGGGAAGAGGTAAAATGG + Intergenic
921466904 1:215499221-215499243 CTGAATGGGAAGAGGAAAGAGGG + Intergenic
922420099 1:225453919-225453941 ATGACTTGTTAGAGGTAAATAGG + Intergenic
922883094 1:228997342-228997364 ATGAAGTGCTATAGGTAAAAAGG + Intergenic
924844171 1:247748912-247748934 CTGTATTTGTATAGGTAAATAGG - Intergenic
1063880017 10:10521635-10521657 CTGAAGTGGTAGAGCCAAAATGG + Intergenic
1064448808 10:15422846-15422868 CTGAATTGGTATGGTTAAAATGG + Intergenic
1065867243 10:29925039-29925061 CTCAAATGGGAGAGGTCAAAGGG - Intergenic
1066285460 10:33961965-33961987 CTGATTTGATATAGGCAAAAAGG + Intergenic
1067024352 10:42830677-42830699 CAGAGGTGGTAAAGGTAAAATGG + Intronic
1068173114 10:53421937-53421959 CTGCTCTGGTGGAGGTAAAAGGG + Intergenic
1068475897 10:57524339-57524361 CTGACCAGGAAGAGGTAAAAAGG + Intergenic
1071861273 10:89675216-89675238 CTAAAATTGTAGAGGAAAAAAGG + Intergenic
1073229494 10:101956412-101956434 CTGAATTCCTAAAGGCAAAAAGG + Intronic
1074512051 10:114122407-114122429 CTGAAGTGGTATGGGGAAAATGG + Exonic
1075329645 10:121564210-121564232 CTGAATAGGGAGAAGTCAAAGGG + Intronic
1075472786 10:122705376-122705398 TTGAATTTGGAGAGGTAATATGG + Intergenic
1080697580 11:34616205-34616227 CTGAATTTGTAAAGGTAATTTGG + Intergenic
1086443102 11:86847995-86848017 CTGAAGTGTTAAAGGCAAAATGG + Intronic
1086463791 11:87033140-87033162 CTGAAATGGTCTAGGTAAAATGG - Intergenic
1086487466 11:87323447-87323469 CTGATTAGTTAGAGGTAGAAAGG - Intronic
1086542166 11:87926006-87926028 TTGAATTGGTAGAGGTAGAGGGG - Intergenic
1087227961 11:95625408-95625430 CTGAATTGTTAGAGGCAAGGTGG + Intergenic
1088553078 11:111034389-111034411 ATGAATGGGAAGAGCTAAAATGG + Intergenic
1089034608 11:115373929-115373951 TTGAATTGGAAGAGTCAAAATGG + Intronic
1089969868 11:122684559-122684581 CTGAATTTGGAGAAGTAAAGAGG + Intronic
1090034997 11:123241609-123241631 TGGAATTGGTAGAGGTGAAATGG + Intergenic
1090316613 11:125796449-125796471 CTGAATTATTTGATGTAAAAAGG - Intergenic
1091185038 11:133639269-133639291 CTGAAATGGTAGGGGTCTAATGG + Intergenic
1092023607 12:5222761-5222783 TTGAGTTGGAAGAGGCAAAAGGG - Intergenic
1094078160 12:26501287-26501309 TTGAATTGCCAGGGGTAAAAAGG + Intronic
1095053723 12:37576864-37576886 CTGAAGAGGTGGAGGTAAAAGGG - Intergenic
1096605154 12:52759896-52759918 GTGAATTGGAAGAGGTCAACCGG + Intergenic
1098137602 12:67419238-67419260 CTAAAAGGGTAGAGGAAAAAGGG - Intergenic
1099310380 12:81013111-81013133 CTGAAGTTGTAGGGATAAAAAGG + Intronic
1099699770 12:86068801-86068823 CTGTACTGCTACAGGTAAAAGGG - Intronic
1099840898 12:87965472-87965494 CTAAATTGGTAGAAAGAAAATGG - Intergenic
1100163789 12:91893418-91893440 CTAAACAGGTAGAGTTAAAAGGG + Intergenic
1100178149 12:92054163-92054185 ATGAGCTGGTAGAGGGAAAAAGG - Intronic
1103155398 12:118680394-118680416 CTTAATTGGAAGAGGAGAAATGG - Intergenic
1103942184 12:124507147-124507169 CTGAATTCATAGAGACAAAAAGG + Intronic
1105730308 13:23208078-23208100 CTGAAATGGTAAAGTTAAATAGG + Intronic
1105999986 13:25712769-25712791 CTGAATTGGTGTATGTTAAAAGG + Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106848085 13:33759425-33759447 CTGCATTGATAGAGGGAAATGGG - Intergenic
1106882720 13:34149374-34149396 CTTAATTTCTAGAGGGAAAATGG + Intergenic
1108894118 13:55301560-55301582 CTGCATTGGTAGAGAAAGAAAGG - Intergenic
1109017444 13:57036082-57036104 CTGAATTAGAACAGGGAAAAGGG + Intergenic
1110941533 13:81355933-81355955 CTGAAGTGTTAGAGGTTGAATGG - Intergenic
1111251490 13:85607487-85607509 CTGACTTGTTAGTGGAAAAATGG + Intergenic
1111434710 13:88191730-88191752 GTGAATTGGCAGAGGTACAGTGG + Intergenic
1116348129 14:43822689-43822711 ATGGATTGGCAGAGCTAAAATGG + Intergenic
1117508528 14:56425981-56426003 AACAAATGGTAGAGGTAAAAAGG - Intergenic
1117734367 14:58754124-58754146 TTGAATTGGTGGAGGAAAAAGGG + Intergenic
1118512111 14:66486825-66486847 CTGGATTCCTAGAGGTAAAAAGG + Intergenic
1122032150 14:98920045-98920067 CTGAAATGGAGGAAGTAAAAGGG + Intergenic
1122497393 14:102168274-102168296 CTTAATTGGCAGCAGTAAAAAGG + Intronic
1123831801 15:24146894-24146916 CTGAATGGGTAGCAGTAGAAGGG - Intergenic
1123836779 15:24202910-24202932 CTGAATGGGTAGCAGTAGAAGGG - Intergenic
1124664710 15:31582409-31582431 ATAAATTGGTAGTGGTAGAATGG - Intronic
1126199789 15:45972881-45972903 CTAAATTGGTAGTGTTCAAAAGG - Intergenic
1126841774 15:52724411-52724433 CTGGATTGGTAGAAGGAGAAAGG - Intergenic
1126911660 15:53423533-53423555 CTGACTGGGTGGAGGTACAATGG - Intergenic
1127032634 15:54880779-54880801 CTGTCTTAGTAGAGGTAAACCGG - Intergenic
1127221231 15:56883848-56883870 CTGAATTGGGAGAGGGTGAAAGG - Intronic
1128532066 15:68461157-68461179 CTGAATTGTTAATTGTAAAAGGG + Intergenic
1129917761 15:79289430-79289452 CTGAAGGGGAAGAGTTAAAATGG + Intergenic
1133455209 16:5935877-5935899 CTGAATTCACAGAGGTATAATGG + Intergenic
1135092405 16:19529099-19529121 ATGAATTCGTAGATATAAAATGG + Intronic
1135332002 16:21568285-21568307 CTCAATTGGTAGAATTAATAAGG + Intergenic
1136002662 16:27306761-27306783 CTGATTTGCCAGAGGTAAGAGGG + Intergenic
1136129369 16:28210343-28210365 CTAACTTGGCAGGGGTAAAATGG + Intronic
1137776472 16:51058740-51058762 CTGAAATGATAAAGTTAAAAGGG + Intergenic
1138327505 16:56188077-56188099 CTGAGTTGGTAAAAGTAAGATGG + Intergenic
1140047666 16:71453351-71453373 CTGGTTTGGGAGAGGTAAATAGG + Intronic
1144052619 17:11509960-11509982 CTGAGATGGGAGAGGTAAGAAGG + Intronic
1145374255 17:22332896-22332918 CTGAAGAGGTGGAGGTAAAAGGG - Intergenic
1148438849 17:47701495-47701517 CTGAATTGGTAGAACTCCAAGGG + Intronic
1153679870 18:7490517-7490539 ATGAAGTGGTAGAGGTACCAAGG + Intergenic
1155708118 18:28841491-28841513 GTGAAATGGTATAGGTAGAAGGG - Intergenic
1156812530 18:41270024-41270046 CTGATTTGGCAGATGTGAAAAGG - Intergenic
1156827296 18:41446626-41446648 CTGAATTTGTACACTTAAAATGG + Intergenic
1160676995 19:396396-396418 CTGAATTGGTCGTGTTAAAGCGG - Intergenic
1161857829 19:6775824-6775846 GTGAAAGGGTAGAGGGAAAAAGG + Intronic
1161956482 19:7498707-7498729 CTAAATAGGTAGAGGTAAGCAGG + Intronic
1165569186 19:36761128-36761150 CTGAAGAGGTGGAAGTAAAAGGG + Intronic
1167019745 19:46864127-46864149 CTGATTGGGTAGAGTTAGAAAGG + Intergenic
925287246 2:2723809-2723831 CTGACTTGGTGGTGGTAAGATGG - Intergenic
925968801 2:9092372-9092394 CAGAATTGTTAGAGTTAAAGAGG - Intergenic
930268393 2:49227107-49227129 CAAATTTGGCAGAGGTAAAAAGG + Intergenic
930743907 2:54861355-54861377 ATGAAGAGGTAGAGGTACAATGG + Intronic
932445017 2:71775067-71775089 CTAAATTGGGAGAGGAAGAATGG - Intergenic
935557197 2:104522659-104522681 CTGAATTGGTAGAATACAAAGGG - Intergenic
937624884 2:124033188-124033210 CTGAATTGATAGAGTTTTAAAGG + Intronic
937827606 2:126383935-126383957 CAGAATTGCTAGAGGATAAAAGG + Intergenic
939857953 2:147383139-147383161 CTGAAATGGGAGAGGGAAGAAGG - Intergenic
940665205 2:156600753-156600775 CTAATTAGGTAGGGGTAAAAAGG - Intronic
942005273 2:171693456-171693478 CTGAAATAGTAGAGGTACACAGG + Intronic
942283268 2:174389093-174389115 GTAAATTGGTATAGGTAGAATGG + Intronic
945997806 2:216453617-216453639 CTGAGTTGGAAGGGTTAAAATGG + Intronic
946989129 2:225308231-225308253 CTGGATTGGGAGAGGAACAATGG + Intergenic
947192471 2:227521656-227521678 CTGAATTGGTAAAAGTAACACGG - Intronic
1170802974 20:19605633-19605655 CTCAATGGGTAGATGTAAGAAGG - Intronic
1172053107 20:32134388-32134410 ATGAATTGCTTGAGGAAAAATGG - Intronic
1177682970 21:24398360-24398382 GTGATTTGGAAGAGCTAAAATGG + Intergenic
1178274504 21:31224671-31224693 CTGAATTGTTCGTGTTAAAATGG + Intronic
1181665944 22:24397168-24397190 CTGTTTTGGCAGAGGGAAAATGG - Intronic
1182571684 22:31243957-31243979 CTGAATTTTTGGAGGTCAAATGG + Intronic
1184768937 22:46586868-46586890 CTGGATGGGCAGAGGTAGAAAGG + Intronic
1185354238 22:50357049-50357071 CTGAATGGCTAAAAGTAAAAAGG - Intronic
949287043 3:2419050-2419072 ATTAATTGGTAGAAGTTAAATGG + Intronic
953302102 3:41787515-41787537 CTGAATTGGCAGGGGGAAGAAGG - Intronic
954954684 3:54508677-54508699 CTGAAGTGGCAGAGGTGAAGGGG + Intronic
955694304 3:61620388-61620410 TTGAATTTGCAGAGGGAAAATGG + Intronic
956128586 3:66034184-66034206 CTGAATTGGTAGAACTAAGGTGG + Intronic
956271141 3:67448085-67448107 ATAAATTGTTAGAAGTAAAACGG - Intronic
956390081 3:68762445-68762467 CTGAATAGGTAGAAGGAAATGGG + Intronic
956916495 3:73877324-73877346 CTGAATTGGAAAAGGTAATTTGG - Intergenic
957384636 3:79479882-79479904 CTGAGTTGGTATAGGTATATTGG - Intronic
959153893 3:102642393-102642415 CTTCATTGGTAGAGATAATAAGG + Intergenic
960378966 3:116936622-116936644 CTGACTTAGTAGATTTAAAATGG + Intronic
962085178 3:132183666-132183688 GTGAATTAGTGGAGGCAAAACGG + Intronic
963931750 3:151010559-151010581 CTGATTGGATAGAAGTAAAAAGG + Intergenic
964288723 3:155151657-155151679 CTGTCTTGGTAGCAGTAAAATGG - Intronic
967902525 3:194470884-194470906 CAGAACTGGCAGAAGTAAAATGG + Intronic
967902963 3:194476114-194476136 CAGAGTTGTAAGAGGTAAAATGG - Intronic
971621557 4:28860474-28860496 CAGAAGTGGAAGAGGTAGAAAGG + Intergenic
972092907 4:35310859-35310881 CTGAGTTGGTGGAGGTAGATGGG + Intergenic
972155142 4:36151696-36151718 CTGAATTACTAAAGGTAAAGTGG + Intronic
972694125 4:41427978-41428000 CTGAATACACAGAGGTAAAAAGG - Intronic
973110771 4:46395101-46395123 GTGAAAAGGTAGAGGAAAAAAGG - Intronic
974235933 4:59180822-59180844 ATTGATTGGTTGAGGTAAAAGGG - Intergenic
977850316 4:101819647-101819669 CTGAGTTGGTAGAGAACAAATGG - Intronic
978015262 4:103736632-103736654 TTGCATTTGTATAGGTAAAATGG + Intergenic
978057624 4:104292015-104292037 GTGAAGGGGTAGAGGTAAAAGGG - Intergenic
979799876 4:124895038-124895060 CTGTATTAGTGGAGGCAAAATGG + Intergenic
981168296 4:141589277-141589299 CTCAATTAGTAGACTTAAAAGGG - Intergenic
981396272 4:144253381-144253403 TGGAATTGGTAGAGAAAAAAGGG + Intergenic
981403910 4:144344524-144344546 CAGAAGTGGAAGAGGAAAAAGGG + Intergenic
981584417 4:146285770-146285792 CTGAGTTTGTAGTGGTAAAAAGG + Intronic
984297164 4:177866775-177866797 TTGAATTAGTATAGGTAAAAAGG + Intronic
984357142 4:178676255-178676277 CTGAATGGGGAGAAGTGAAAAGG + Intergenic
984822909 4:183898658-183898680 CTGAATGGGCAGAGGTACCATGG + Intronic
985167744 4:187115494-187115516 CTCAATCAGTAGAGGTTAAAGGG - Intergenic
985796645 5:1966955-1966977 CTGAATTTGTAAAGGAGAAAAGG - Intergenic
987290544 5:16504520-16504542 CTGAAGTGGGAGAGGTACATAGG - Intronic
987931419 5:24403775-24403797 CTGTATTGGTAGAGTTATACTGG - Intergenic
990967627 5:61466186-61466208 CAGAGTTGGGAAAGGTAAAAGGG + Intronic
992537382 5:77721556-77721578 CTGATTTGGTATATGTTAAAGGG + Intronic
996266642 5:121549221-121549243 CTGAATTAGTGGAGGAAAGAAGG - Intergenic
1000720925 5:164705601-164705623 CTGTGTTGGTAGAGGTAGGATGG + Intergenic
1000884440 5:166735243-166735265 GTCAAATGGTAGAGGTGAAAAGG + Intergenic
1001122175 5:168989893-168989915 CAGAACTGTTAGAGATAAAAGGG - Intronic
1001203364 5:169739301-169739323 CTGTAATTGTAGAGGGAAAATGG + Intronic
1001337703 5:170813786-170813808 CTGAATTGTGAGAAGTATAATGG - Exonic
1004587566 6:17016627-17016649 CTGAAGTTTTAGAAGTAAAATGG - Intergenic
1005078149 6:21928774-21928796 CAGAATGAGGAGAGGTAAAATGG - Intergenic
1007850612 6:44799248-44799270 CTGAAATGGAGAAGGTAAAATGG - Intergenic
1009552926 6:65122405-65122427 CTGGATTGGTAGACATAATAAGG + Intronic
1011233958 6:85194513-85194535 CTGAGTTGATAGAGGTAGGAAGG + Intergenic
1013644468 6:112122899-112122921 TTGAATGGGTAGAAGTAAAGGGG + Intronic
1013676764 6:112472800-112472822 CTGAGTTTTTAGAGGTAAAGTGG - Intergenic
1014280621 6:119439507-119439529 CTGAATTGGTAAAAAAAAAAAGG - Intergenic
1014319537 6:119909426-119909448 CTAAATTAGCAGAGGTAGAAGGG - Intergenic
1014566614 6:122956680-122956702 CTGATTTGGTGGAGGTAGCAGGG - Intergenic
1015288363 6:131509987-131510009 CCTAAATGGTAGAGGCAAAATGG + Intergenic
1015935947 6:138405729-138405751 CTTAATTTTTAGAGATAAAAGGG - Intronic
1016637293 6:146307705-146307727 CCCAATTAGAAGAGGTAAAAAGG - Intronic
1017061079 6:150485547-150485569 CTGAACAGGTAGAGGGCAAAGGG - Intergenic
1020363359 7:7353597-7353619 CTCAATTGGTAGAGATGAGAGGG + Intergenic
1021242879 7:18226455-18226477 CTGACCTGGTAGATTTAAAAAGG - Intronic
1021645955 7:22789667-22789689 CAGACTTGGTAGAGGGGAAATGG - Intergenic
1022607648 7:31832075-31832097 CTGAATTGATAAAAATAAAAAGG + Intronic
1027939643 7:84658782-84658804 GTGAATTGGAAAAGCTAAAAAGG - Intergenic
1028861997 7:95662812-95662834 CCGAAATGGGAGAGTTAAAAAGG + Intergenic
1030667659 7:112298482-112298504 ATAAATTTGAAGAGGTAAAATGG + Intronic
1032608818 7:133389112-133389134 ATGAATTGGTAGAGGAGAAATGG + Intronic
1033471100 7:141649905-141649927 CTGTATTGGAAAAGGGAAAAAGG - Intronic
1034590701 7:152136614-152136636 CTGAAGTGGCCGAGGTTAAACGG - Exonic
1036529722 8:9573133-9573155 CTGAGTTGGGAAAGATAAAAAGG - Intronic
1039322179 8:36444332-36444354 CTGAATTTCAAGAGGTGAAAGGG - Intergenic
1039575453 8:38620176-38620198 CTGAATGGGCAGAGGGAAAAAGG - Intergenic
1045065969 8:98444564-98444586 CTGAACTGGCAGAGGTAGAATGG + Intronic
1045476082 8:102553996-102554018 GTGAATTGGAAGAGATAAAGCGG - Intronic
1045724549 8:105157269-105157291 ATGAATTTGTAGAGCAAAAATGG - Intronic
1047900564 8:129417227-129417249 CTAAATTGGTAAAGGTAGAATGG - Intergenic
1048793529 8:138127503-138127525 CAGAATTGGAAGAGGAAAAATGG - Intergenic
1051067639 9:13123560-13123582 TTAAATTGGTAGAGATATAAAGG + Intronic
1051186264 9:14464504-14464526 CTGAAGTGTTGGAGGAAAAAGGG + Intergenic
1052410979 9:28120668-28120690 CAGAATTTCTAGATGTAAAATGG + Intronic
1053796504 9:41731655-41731677 CTGAAGAGGTGGAGGTAAAAGGG + Intergenic
1054148675 9:61583165-61583187 CTGAAGAGGTGGAGGTAAAAGGG - Intergenic
1054184910 9:61943714-61943736 CTGAAGAGGTGGAGGTAAAAGGG + Intergenic
1054468436 9:65514322-65514344 CTGAAGAGGTGGAGGTAAAAGGG - Intergenic
1054653597 9:67644785-67644807 CTGAAGAGGTGGAGGTAAAAGGG - Intergenic
1054949147 9:70830438-70830460 CTGAATTGGTCATGGCAAAAGGG + Intronic
1055222918 9:73959633-73959655 CAGAAGTGGTAAAGGTTAAATGG - Intergenic
1057389461 9:94630615-94630637 CTGAGTTGATACAGGTAAAGTGG + Intronic
1057864596 9:98669145-98669167 CTGCATTGCTGGTGGTAAAATGG - Intronic
1058033375 9:100224346-100224368 CTGAATAGGGAGAGATAAATAGG + Intronic
1058279781 9:103099525-103099547 GTAAATTGGTAGTGGTAGAATGG - Intergenic
1058455577 9:105135027-105135049 TTGAATTTGGAGAGGTAGAAAGG + Intergenic
1059301819 9:113319898-113319920 CTGAATTGGTAGTAGGAAAGAGG - Intronic
1060441662 9:123645501-123645523 CTGAATTTGAAGAGGTCCAAAGG + Intronic
1186751943 X:12630432-12630454 CTTCATTGGTTGAGGTCAAAGGG - Intronic
1187303347 X:18073031-18073053 CAGACTTTGTAGAGGAAAAAGGG + Intergenic
1187828573 X:23357598-23357620 CTCCATTGGTAGAAGAAAAATGG + Intronic
1188837959 X:34981775-34981797 CTGAATAGAATGAGGTAAAAGGG - Intergenic
1189511326 X:41664969-41664991 CTTAATTTGTAAAGTTAAAATGG - Intronic
1189752190 X:44233684-44233706 CTGAATTCTTATTGGTAAAATGG + Intronic
1189759211 X:44304281-44304303 GTAAATTGCCAGAGGTAAAAGGG + Intronic
1190578454 X:51866748-51866770 CTGAATGGGTAGAGTTACCATGG - Intronic
1191055119 X:56232914-56232936 CTGAATTGGTAGAGGTAAAAGGG + Intronic
1192938219 X:75883423-75883445 CTGATTAGGTAGAGGAAGAAAGG - Intergenic
1196119816 X:112037766-112037788 TTCAGTTGGTAGAGGTGAAATGG + Intronic
1196274115 X:113746595-113746617 CTGAATGGCTAGAGACAAAAAGG - Intergenic
1196468229 X:115994063-115994085 CTGCAGTGGTAGAGGTAAGCGGG - Intergenic
1197660423 X:129165103-129165125 CAGAATTGATAGAGGTAATCAGG - Intergenic
1198379719 X:136072496-136072518 CAGAATTGTGGGAGGTAAAATGG - Intergenic
1199325384 X:146492884-146492906 CTGAATTGGTTGCTGTTAAAAGG + Intergenic