ID: 1191057306

View in Genome Browser
Species Human (GRCh38)
Location X:56254966-56254988
Sequence AATTCTAGGCAGAAGTGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 597
Summary {0: 1, 1: 4, 2: 57, 3: 163, 4: 372}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191057306_1191057312 5 Left 1191057306 X:56254966-56254988 CCTGCCCACTTCTGCCTAGAATT 0: 1
1: 4
2: 57
3: 163
4: 372
Right 1191057312 X:56254994-56255016 GCCTCCTGTCCCTGTCAGTATGG 0: 1
1: 0
2: 4
3: 26
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191057306 Original CRISPR AATTCTAGGCAGAAGTGGGC AGG (reversed) Intronic
900196342 1:1377760-1377782 TATTATAGGCAGATGTGCGCTGG - Intergenic
901549986 1:9989007-9989029 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
901871641 1:12142056-12142078 AATCCTAAGTACAAGTGGGCTGG + Intronic
902175167 1:14644309-14644331 AATTCTATTAAAAAGTGGGCAGG - Intronic
902337112 1:15759867-15759889 AAATTTAGGCAGAAGTGGCGGGG - Intronic
903601614 1:24546236-24546258 AATTCTAGGCTGAAAAGGACAGG + Intergenic
904222554 1:28984322-28984344 AATTCTAGGCAGAAAAGGACGGG - Intronic
904577451 1:31514202-31514224 AGTCCTGGGCAGAAGGGGGCAGG - Intergenic
905334420 1:37234478-37234500 AAGTCTGGGCTGAAGTGGACAGG - Intergenic
906035581 1:42748501-42748523 AGTTCTTGGCAGAAGTGAGCAGG + Intronic
906152058 1:43593130-43593152 AATTCAAGGCACACGTGGGCAGG - Intronic
906516222 1:46440342-46440364 GATGCTGGGCAGAATTGGGCTGG + Intergenic
906723450 1:48025976-48025998 AGTCCTAGGCAGAAATTGGCAGG + Intergenic
908702730 1:66919965-66919987 AATTCTGGGCAGAAGAAGGCAGG + Intronic
909185667 1:72482218-72482240 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
909570590 1:77105437-77105459 AATTCTAGGCAGATAGGGGTGGG - Intronic
909692687 1:78427020-78427042 AATTCTAAGCAGTAGAGGGTTGG + Intronic
909775454 1:79479037-79479059 AATTCTAGGCAGAAAAGGGTGGG - Intergenic
910150303 1:84134354-84134376 AATTCTAGGCAGAAAAGGGCAGG - Intronic
910400216 1:86830853-86830875 AATTCTAGGCCGAGGTGGGCGGG + Intergenic
910617017 1:89209519-89209541 ACTTCCAGCCAGAAATGGGCAGG - Intergenic
911205774 1:95090357-95090379 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
911509192 1:98790975-98790997 AATTCTTGGCAGAAGAGAGTGGG + Intergenic
911546678 1:99225375-99225397 AATACTTGGTAGAAGAGGGCGGG - Intergenic
911883569 1:103270447-103270469 AGTTATAGGCAGAAGATGGCAGG - Intergenic
913097623 1:115534546-115534568 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
914684933 1:149969996-149970018 AAATCTATTCAGAAGGGGGCTGG - Intronic
915498918 1:156301009-156301031 AATCCTAGGCAGACAGGGGCAGG + Intergenic
915797410 1:158751889-158751911 ATTCCTGGGCAGAAGGGGGCAGG - Intergenic
916693042 1:167209444-167209466 AGTTCTAGGGACAATTGGGCTGG + Intergenic
917210960 1:172631764-172631786 AATACTAGGCAGAAAAGGGTGGG + Intergenic
917371926 1:174301991-174302013 AATCCTAGGCAGACAGGGGCAGG - Intronic
918562180 1:185881631-185881653 AATTCTAGGCAGAAAAGGGTAGG - Intronic
918792548 1:188847422-188847444 AATTCTAGGCAGACAGGGGCGGG - Intergenic
918910510 1:190562629-190562651 AATTCTAGGCAGACAAGAGCAGG + Intergenic
919240782 1:194914037-194914059 AATTCTAGGCAGAAAAGGGTGGG + Intergenic
919314513 1:195954486-195954508 AATTCTATGCAGAAGAGGGAAGG + Intergenic
921367706 1:214389446-214389468 AAATATAGACAGAAGAGGGCAGG + Intronic
921674964 1:217966607-217966629 AATTCTGGGCAGAGGAGGGTGGG - Intergenic
921679970 1:218020109-218020131 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
922132723 1:222795442-222795464 GTTCCTGGGCAGAAGTGGGCAGG + Intergenic
922876400 1:228943056-228943078 AATTCTGGGCAGAAAAGGGTGGG + Intergenic
923011164 1:230088830-230088852 AAAACTAGACAGAAGTGGCCGGG - Intronic
923306535 1:232693917-232693939 AATTCTGGGCAGAAGAGAGCGGG + Intergenic
923397736 1:233583852-233583874 AATTCTAGGCAGGAAAGGGCAGG + Intergenic
923443163 1:234040469-234040491 AACTCTAGGCAGACAGGGGCGGG - Intronic
923701065 1:236301072-236301094 AATTCTGGGCAGAAGAGAGTGGG + Intergenic
923892883 1:238235324-238235346 AATTCTAGGTAGAAAAGGGCGGG - Intergenic
923911041 1:238444564-238444586 TATTCCAGGCAGAAAAGGGCAGG + Intergenic
923944327 1:238865313-238865335 GATTCTAGGCAGAAAAGGGTGGG - Intergenic
924818416 1:247463376-247463398 AATTCTAGGCAGAAAAGGGTGGG - Intergenic
924902640 1:248418072-248418094 AATTCTGGGCCGAAGAGGGTGGG + Intergenic
1064320655 10:14301367-14301389 AATTGTTGTCAGAAGTGGGATGG + Intronic
1064785215 10:18887661-18887683 AATACTGGGTAGAAGAGGGCGGG + Intergenic
1064927122 10:20581753-20581775 AATTCTATGCAGAAAAGGGAGGG + Intergenic
1065056925 10:21854692-21854714 GATTCAAGGCAGAAGAGAGCAGG + Intronic
1065979473 10:30878073-30878095 AATTCTAGGCAGACAGGGGCGGG + Intronic
1066281612 10:33923488-33923510 AATTCTAGGCAAAAGAGGGCGGG + Intergenic
1067266343 10:44748618-44748640 AATTCTAGGCAGACATGGGTGGG - Intergenic
1068681224 10:59822738-59822760 AATTCTAGGCAGAAAAGGGTAGG + Intronic
1068904476 10:62307611-62307633 AATTCTGGGCAGAAGAGGATGGG - Intergenic
1069198211 10:65581160-65581182 AATCCTAGGCAGACAGGGGCAGG + Intergenic
1069776291 10:70929173-70929195 TGTTCTGGACAGAAGTGGGCTGG - Intergenic
1070240363 10:74674157-74674179 ATTTCTGGGCAGAAGAGGGTAGG - Intronic
1071068916 10:81669352-81669374 AATCCTAGGCAGACAGGGGCAGG + Intergenic
1071152644 10:82652742-82652764 AATTCTAGGCAGACAGGGGTGGG - Intronic
1071428500 10:85583273-85583295 AATTCTAGGCAGAAAAGGGTGGG - Intergenic
1072208695 10:93226560-93226582 AATTCTAGGCAGACAGAGGCAGG - Intergenic
1072905479 10:99449339-99449361 AAGTCTAGGCAGAAGGTGGAAGG + Intergenic
1073301604 10:102474304-102474326 TATTCTAGTCAGGGGTGGGCTGG + Intronic
1073368651 10:102967014-102967036 AATTCGAGGCTAAAGTGAGCTGG - Intronic
1076432115 10:130411424-130411446 AATGCCAGGCAAAAGAGGGCAGG + Intergenic
1077778494 11:5298148-5298170 AATTTTAGGCAGAAAAGGGCGGG - Intronic
1079344722 11:19641919-19641941 AATTTTAGGTAGAAATGGGAGGG - Intronic
1079573705 11:21976669-21976691 AATTCTAGGCAGAGAGGGGTGGG - Intergenic
1079853670 11:25571970-25571992 CATTTCAGGCAGAAGTGGGTGGG - Intergenic
1080604467 11:33853256-33853278 AATTCTAGGCAGACAGGGGTGGG - Intergenic
1081001657 11:37680802-37680824 AACTCTGGGCAGAAGAAGGCAGG + Intergenic
1081022829 11:37968542-37968564 AATTCTAGGCAGACACGAGCGGG - Intergenic
1081332990 11:41826822-41826844 AATTCAAGGCAGAAAAGGGCAGG - Intergenic
1081334016 11:41842247-41842269 AACTCTAGGCAGACGGTGGCAGG + Intergenic
1082645597 11:55720484-55720506 AATTCTAGGCAGACAAGGGCAGG - Intergenic
1083048412 11:59755951-59755973 AGTGCCAGGCAGCAGTGGGCAGG - Intronic
1083102732 11:60326769-60326791 AATTCTGTGCAGAAGAAGGCAGG - Intergenic
1083752963 11:64771973-64771995 AATTCTAGACAGCTGTGGGGTGG - Intronic
1084095087 11:66906036-66906058 AGTTTCAGGCAGAGGTGGGCGGG + Intronic
1084844596 11:71889083-71889105 CTTTCTAGGCTGAAGTGGCCTGG - Intronic
1085870832 11:80347344-80347366 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1086286219 11:85254133-85254155 AATTGTTGGCAGAAGTGGGCAGG - Intronic
1086783003 11:90930623-90930645 AATTCTAGACAGAAAAAGGCAGG + Intergenic
1087005471 11:93466714-93466736 AATTCTAGGCAAGAAAGGGCGGG + Intergenic
1087608482 11:100405726-100405748 AATTCTACGTAGAAAAGGGCAGG - Intergenic
1087698728 11:101412056-101412078 AATACTAGGCAGAAAAGGGGAGG + Intergenic
1087991566 11:104749779-104749801 AACTATTGGCAGAACTGGGCTGG + Intergenic
1088715383 11:112544272-112544294 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1089694648 11:120209792-120209814 AAATCTAGGCAGCAGAGAGCGGG + Intergenic
1090660574 11:128879086-128879108 AATGCTGGGGGGAAGTGGGCAGG + Intergenic
1091671127 12:2452965-2452987 AATCCCAGGCAGAAGTTGCCAGG - Intronic
1092508083 12:9124799-9124821 ACTCCTGGGCAGAAGGGGGCAGG + Intergenic
1092552052 12:9513778-9513800 AATTCTGGGAATAAGTGGCCAGG + Intergenic
1092680129 12:10969452-10969474 AATTCTAGACAGAAAAGGGCGGG - Intronic
1092850885 12:12625231-12625253 AATTCTAGACAGAAAAGGGTGGG - Intronic
1093268437 12:17027931-17027953 AATTCTAGACAGAAGAGGGCAGG + Intergenic
1093401772 12:18754483-18754505 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
1093731291 12:22568458-22568480 AATTCTAGGCAGACAGGGGCGGG - Intergenic
1093755861 12:22851085-22851107 AACTCTAGGCAGACAGGGGCAGG - Intergenic
1094070187 12:26404197-26404219 AACTGTAGGCAGAAGGGGGAAGG + Intronic
1094160360 12:27383598-27383620 CATACCAGGCAGAAGTGGGCTGG - Intronic
1094520069 12:31176844-31176866 AATTCTGGGAATAAGTGGCCAGG - Intergenic
1095270132 12:40208853-40208875 TATTTTACACAGAAGTGGGCTGG + Intronic
1095854181 12:46842452-46842474 AATTCTAGGCAGTAGTGTGGAGG + Intergenic
1096170285 12:49463003-49463025 AATTCTAGGCAGAAAAGGGTGGG - Intronic
1096323249 12:50634181-50634203 ACTTCCAGGGAGAAGTGGCCAGG + Intronic
1097661809 12:62438304-62438326 AATTCTAGCCAGCAGGGGGCAGG + Intergenic
1098003361 12:65969004-65969026 CATTCTGGCCAGAAGTGGGTGGG + Intergenic
1098929904 12:76399209-76399231 AAGTCTTGGCAAAAGTGGGTTGG + Intronic
1098936837 12:76490226-76490248 AATTCTAGGCAGAAAACGGCAGG + Intronic
1099540828 12:83905155-83905177 AATTGTAGGCAGAAAAGGGCAGG - Intergenic
1099543803 12:83950724-83950746 AATTCTGGACAGAAGAGGGCGGG + Intergenic
1099550010 12:84032616-84032638 ATTTCTAGGCAGAAAGGGGTGGG + Intergenic
1100293007 12:93235436-93235458 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
1100594629 12:96061248-96061270 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1100757988 12:97773361-97773383 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1101148820 12:101866300-101866322 AATTCTAGGCAGACAGGGGCAGG + Intergenic
1101217399 12:102597600-102597622 AATTCTGGGAAGAAGAGGGCAGG - Intergenic
1101432771 12:104640818-104640840 AATTCTGGGCAGAAGAGGGTTGG + Intronic
1101901922 12:108797362-108797384 AATTCTAGGCAGACAGGTGCGGG + Intronic
1104219303 12:126766754-126766776 AATCCTAGGCAGACAAGGGCGGG + Intergenic
1104265780 12:127231445-127231467 AATTCTGGGCAGAAAAGGGCAGG + Intergenic
1105639683 13:22249648-22249670 AATTCTGGGCAGAAGAGGGTAGG + Intergenic
1106136581 13:26978114-26978136 AGTTCAAGGCTGCAGTGGGCTGG - Intergenic
1106620256 13:31365278-31365300 ATTTCTGGCCAGAAGTGGGTGGG + Intergenic
1106870182 13:34011164-34011186 AATTCTAGGGAGAAAAGGGCGGG + Intergenic
1107217217 13:37935229-37935251 AATTCCAGGCAGAAAACGGCAGG - Intergenic
1107854092 13:44597644-44597666 AATTCTGGGAAGAAGAGGGCAGG - Intergenic
1107875124 13:44783459-44783481 AATTCTGGTCAGAAGAGGGTGGG - Intergenic
1108017028 13:46086683-46086705 GATCCTAGGCAGAAAAGGGCGGG - Intronic
1108316505 13:49242355-49242377 AATTCTAGGCAGACAGGGGCAGG + Intergenic
1108487635 13:50942970-50942992 AATTCTGGGCAGAAGAGGGCCGG - Intronic
1108945203 13:56014586-56014608 AATTCTAGGCAGACAAGGGTAGG + Intergenic
1108958448 13:56189544-56189566 AATTCTGGCCAGAAGAGGGTAGG + Intergenic
1109039226 13:57310669-57310691 AATTCTAGGCAGACAGGGTCGGG + Intergenic
1109419975 13:62099608-62099630 AATTCTAGGCAGAAAAGGATGGG + Intergenic
1109593778 13:64522953-64522975 AATCCTAGGCAGACAAGGGCAGG - Intergenic
1109693824 13:65927607-65927629 AATTCTAGGCAGAAAAGTGCAGG - Intergenic
1109705847 13:66092146-66092168 AATTCTAGGCAGACAGGGGTGGG + Intergenic
1109882983 13:68506596-68506618 AATTCTAGGCAGACAGGGGCAGG + Intergenic
1109927670 13:69167696-69167718 AATTCTAGGCCGAAAAGGGTGGG + Intergenic
1110159040 13:72353130-72353152 AATTCTAGGCAGAAAAAGGTAGG - Intergenic
1110339219 13:74369555-74369577 AGTTCCAGGGAGAAGTTGGCTGG - Intergenic
1110782467 13:79481687-79481709 AGTCCTAGGCAGGAGTGCGCAGG - Intronic
1110938261 13:81318964-81318986 AACTCTAGGCAGACAGGGGCAGG + Intergenic
1111104718 13:83629934-83629956 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1111606474 13:90546061-90546083 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1112534641 13:100240166-100240188 AATTTAAAGCAGAAATGGGCTGG - Intronic
1113014929 13:105818041-105818063 AAGGCCAGGGAGAAGTGGGCAGG + Intergenic
1113559070 13:111263270-111263292 AATTCTTGGGAGAATTGGTCTGG + Intronic
1116130831 14:40854470-40854492 AGTCCTATGCAGAAGGGGGCAGG + Intergenic
1116396485 14:44453041-44453063 AATTCTGGGCACAATAGGGCTGG - Intergenic
1116484726 14:45433936-45433958 ATTTCAAGAGAGAAGTGGGCTGG + Intergenic
1116716408 14:48431753-48431775 AATTCTAGGCAGACAGGGGCGGG - Intergenic
1116800605 14:49439568-49439590 AATTCTGGTCAAAAGTGGGTGGG + Intergenic
1117357080 14:54934700-54934722 TATTCTGGACTGAAGTGGGCAGG + Intergenic
1118408570 14:65452005-65452027 AATTCTAGGCAGAAAATGGTGGG - Intronic
1119036156 14:71231725-71231747 ACTCCTGGGCAGAAGGGGGCTGG + Intergenic
1119562619 14:75603147-75603169 AATTCTAGGCAGAAAAGGGTGGG + Intronic
1120363324 14:83533943-83533965 AAATGTAGGCAGAAGAGGACTGG - Intergenic
1120422141 14:84302094-84302116 ATTCCTAGGCAGAAAGGGGCGGG + Intergenic
1121891618 14:97598298-97598320 AATTCTAGTCAGAAGGAAGCAGG + Intergenic
1122643278 14:103175050-103175072 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1122915488 14:104856426-104856448 AAGCCTAGGCAGAAGAAGGCAGG + Intergenic
1123018638 14:105387300-105387322 CATTCTCGGCAGAGGAGGGCGGG - Intronic
1123479495 15:20617896-20617918 AATTCAGGGCAGAAATGGGGAGG - Intergenic
1123638512 15:22382468-22382490 AATTCAGGGCAGAAATGGGGAGG + Intergenic
1123765206 15:23471165-23471187 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1125000157 15:34761229-34761251 TATTTTATGCAGAAGTGGGATGG + Intergenic
1125381610 15:39092485-39092507 GTTCCTGGGCAGAAGTGGGCGGG - Intergenic
1125868252 15:43075581-43075603 AATTCTAGGGGGGAGTGGGGAGG - Intronic
1126212049 15:46111145-46111167 AATTCTAGGCAGAAAAGAGTGGG + Intergenic
1126333796 15:47564656-47564678 AATTCTAGGGAGAAAAGGGCGGG + Intronic
1126654174 15:50957565-50957587 AATTCTAGGCAGAAAAGGGTGGG - Intronic
1127017776 15:54708237-54708259 ATTCCTGGGCAGAAGGGGGCGGG - Intergenic
1127175593 15:56352174-56352196 AATCCTAGACAGGAGTGGGTTGG + Intronic
1128616406 15:69114009-69114031 AAAGCTTGGCAGAAGTGTGCAGG - Intergenic
1128637406 15:69312010-69312032 AATTCCTGGAGGAAGTGGGCTGG + Intronic
1129627473 15:77217311-77217333 CATTCAAAGCAAAAGTGGGCTGG + Intronic
1129789964 15:78334478-78334500 AGTTCTGGGCAGAAGAGGGATGG - Intergenic
1130420746 15:83744902-83744924 AACTCTGGGCATAAGAGGGCGGG + Intronic
1131695788 15:94876274-94876296 AATCCTAGGCAGATGGGAGCAGG - Intergenic
1131814744 15:96211037-96211059 AACTCTGGGCAGAAGAGGGCAGG + Intergenic
1131881483 15:96867393-96867415 AATTCTAGGCAGAAAAGGGTGGG + Intergenic
1131931554 15:97448584-97448606 AATTCTGGGCGGAAGAGGGCAGG + Intergenic
1132160462 15:99536795-99536817 TATTCAAGGCAGAAATGGGAAGG - Intergenic
1134873914 16:17678325-17678347 ACTTCTAGGAAGAAGGGGGTTGG - Intergenic
1135057105 16:19240688-19240710 GCTTCTGGGCAGAAGAGGGCTGG - Intronic
1135256978 16:20948771-20948793 AATTCCGGGCAGAAGATGGCGGG + Intronic
1135878912 16:26233133-26233155 AATTTTTGGCAGCAGTGGGTGGG + Intergenic
1135887977 16:26329615-26329637 AATTCTAGGTAGAAGAGGGAGGG - Intergenic
1136187485 16:28596761-28596783 AATTCAAGGCTGCAGTGGCCAGG + Intronic
1136189958 16:28609686-28609708 AATTCAAGGCTGCAGTGGCCAGG + Intronic
1137815624 16:51395245-51395267 AATTCTGGGCAGACAGGGGCAGG + Intergenic
1138061713 16:53898255-53898277 AATCCTGGGCAAGAGTGGGCTGG - Intronic
1138796344 16:59974185-59974207 AATCCTGGGCAGGATTGGGCAGG + Intergenic
1138852141 16:60641871-60641893 AATTCTAGGCAGAAAAGGGTGGG - Intergenic
1139178690 16:64720194-64720216 AAGTCTGGGTAGAAGTGAGCAGG + Intergenic
1139258924 16:65573450-65573472 AATTCTAGGCATTAGTGAGAGGG - Intergenic
1139555157 16:67703571-67703593 AATTCCAGACAGAAAGGGGCAGG - Intronic
1140075976 16:71699183-71699205 AATTCTAGGCAGACAGGGACAGG + Intronic
1140805773 16:78530703-78530725 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1141046474 16:80720074-80720096 ATATTTAGGCAGAAATGGGCAGG + Intronic
1141898433 16:86973835-86973857 CATTCTAGGCACAAGCAGGCTGG + Intergenic
1142301813 16:89263019-89263041 AATTCTAGGCAGACAGGGGCAGG - Intergenic
1145217938 17:21066256-21066278 AATGCCTGGCAGAAGGGGGCTGG - Intergenic
1146549518 17:33768585-33768607 AATCCTAGGCAGACAGGGGCAGG + Intronic
1147230122 17:39011651-39011673 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1147513402 17:41093649-41093671 AATTCTAGGCAGAAAAGGATAGG + Intronic
1147515492 17:41113944-41113966 AATTCTAGGCAGAAAAGGGTAGG + Intergenic
1147748816 17:42713663-42713685 AATTCGAGGCTGCAGTGAGCAGG - Intronic
1148109623 17:45137188-45137210 AGGTCTAGGCTGAGGTGGGCTGG + Intronic
1148114238 17:45165714-45165736 TATTCCAGGCAGAAGTTGGTAGG - Intronic
1148537716 17:48454840-48454862 AATTCTCGGCAGAAAAGGGCAGG + Intergenic
1148640454 17:49183666-49183688 AGTCCTGGGCAGAAGTGGGTGGG - Intergenic
1148865377 17:50625658-50625680 AAGTCTAGGCAGAGGCGGGGAGG + Intronic
1149160448 17:53686998-53687020 AGTTCTGGGCAGAAGTGGGTGGG - Intergenic
1149237233 17:54606877-54606899 AATTATAGGCAAAAAAGGGCAGG + Intergenic
1150932031 17:69595635-69595657 AATTCTAGGCAGACAGGGGTGGG + Intergenic
1151895132 17:76974962-76974984 GGTTCCCGGCAGAAGTGGGCAGG + Intergenic
1153703163 18:7717112-7717134 AATTCTAGGCAGAAAAGGGATGG + Intronic
1153703892 18:7725405-7725427 AATTCTGGGCAGAAAAGGACGGG + Intronic
1154363790 18:13688150-13688172 AATTCTAGGCAGACAGGGACAGG + Intronic
1154384412 18:13880268-13880290 AATTCTAGGCAGACAGGGGTGGG + Intergenic
1155017976 18:21864120-21864142 AATTCTAGGCAGACAAGGGTGGG - Intronic
1155454366 18:25995695-25995717 AGTTCGAGGCAGCAGTGAGCTGG - Intergenic
1155516730 18:26630629-26630651 AACACTAAGCAGACGTGGGCTGG - Intronic
1155799923 18:30089108-30089130 AATTCTAGGCAGACAGGGGAAGG + Intergenic
1155840268 18:30633964-30633986 AATTCTAGGCAGACAGAGGCAGG - Intergenic
1156400705 18:36736852-36736874 AATTCTAGGCAGAAAAGGGTGGG - Intronic
1156713561 18:39977663-39977685 AATTCAAGGCAGAAAAGAGCAGG - Intergenic
1156905547 18:42348309-42348331 AATTCTAGGCAGACAGGGGGAGG + Intergenic
1156946970 18:42844832-42844854 AATTCTAGGCAGATAGGGGCAGG - Intronic
1157682354 18:49616961-49616983 AATTCTAGGCATCAGTGAGGAGG - Intergenic
1157792509 18:50545465-50545487 AATTCTAGGCAGAAAAGTGCAGG + Intergenic
1158014432 18:52766855-52766877 AATTCTAGGCAGAAAAGGGTCGG - Intronic
1158159581 18:54465704-54465726 AATTCTGGACAGAAGAGGGCAGG - Intergenic
1158968479 18:62644340-62644362 AATTCTAGGCAGAAAAGGGTGGG + Intergenic
1159030584 18:63226395-63226417 AATTCTGGGCAGAAGAGGGTGGG - Intronic
1159564184 18:70029944-70029966 ATTTCTAGGCACAAGAGGACTGG + Intronic
1159666066 18:71162035-71162057 AATTCTAGGCAGAAGAGGGCAGG + Intergenic
1159777551 18:72620704-72620726 AATTCTAGGCAGACGAGGGTAGG - Intronic
1160292799 18:77609421-77609443 ATTTCTGGGCAGAAGGGGGCGGG + Intergenic
1160467493 18:79093731-79093753 AATTCTAAGCAGATGGGGGAGGG - Intronic
1164704005 19:30305737-30305759 TCTTCTAGGCAGAATTGGGTGGG + Intronic
1165300800 19:34967533-34967555 AATTCTGGGCAGAAGAGGCCAGG + Intergenic
1165903451 19:39179351-39179373 AACTCGAGGCAGGGGTGGGCGGG - Exonic
1167135474 19:47612946-47612968 AATTCTCGGGGGAGGTGGGCAGG + Intronic
925234902 2:2269537-2269559 AATGCAAGGCAGAAGTAGGATGG - Intronic
925984160 2:9201839-9201861 AATTATACTCAGAAGTGGGCTGG + Intergenic
926542953 2:14204266-14204288 AATTCTAGGCAGAAAAGAGCAGG + Intergenic
926805105 2:16701180-16701202 AATTCAAGGCCAATGTGGGCTGG + Intergenic
927613599 2:24566646-24566668 ACTTCTGGGCAGAAAGGGGCAGG - Intronic
928813046 2:35253299-35253321 AATTCTAGGCAGAAAAGGGTGGG + Intergenic
928860091 2:35846746-35846768 AATTCTAGGCAGAAAAGTGGCGG - Intergenic
929152244 2:38757904-38757926 AATTCTAGGAAACAGTGGGGTGG + Intronic
929885966 2:45878978-45879000 AATTCTAGACGGAAAAGGGCTGG + Intronic
929906926 2:46054660-46054682 AATTCGGGGCAGAAGAGGGCAGG + Intronic
930515384 2:52401463-52401485 AATTCTAGGCAGACAGGGGTGGG + Intergenic
930525472 2:52524475-52524497 AATTCTAGGCAGACAGGGGAGGG + Intergenic
930527221 2:52545328-52545350 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
930783499 2:55247631-55247653 AATACTAGGAATAAGTGGGTGGG - Intronic
930818359 2:55621210-55621232 AATCCTAGGCAGACAGGGGCAGG + Intergenic
931248320 2:60509295-60509317 ATTTCTGGAAAGAAGTGGGCTGG - Intronic
931458611 2:62431861-62431883 AATTCTGGGCAGAAGTGGGTGGG + Intergenic
931462897 2:62463666-62463688 AATTCTAGGCAGAAAAGAGCGGG + Intergenic
931567200 2:63627408-63627430 AATTCTAGGCAGAAAAGGGCGGG + Intronic
931938893 2:67230560-67230582 AATTCTAGGCAGAAAAGGGTAGG + Intergenic
933462847 2:82611821-82611843 AATACTAGGAAGAAAAGGGCAGG + Intergenic
933551416 2:83781810-83781832 AATTCAGGGCAGATTTGGGCAGG + Intergenic
933817191 2:86077523-86077545 AAGACTAGGCTGAAGTGGGCAGG + Intronic
933882268 2:86681319-86681341 AATTCTAGGCAGAAAAGAGTGGG - Intronic
935175851 2:100648192-100648214 TATTCTGGGCAGAAGCAGGCGGG + Intergenic
935426980 2:102929892-102929914 CGTTCTAGGCAGAAGGGGGGAGG - Intergenic
936657571 2:114506041-114506063 AATTCTGGGCAGAAGAAGGCAGG + Intronic
936858352 2:116987044-116987066 AATTCTGGGCAGACAAGGGCGGG + Intergenic
937840342 2:126518741-126518763 AATTCTAGGCAGAAAAAGGCAGG + Intergenic
937891253 2:126940596-126940618 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
938089610 2:128422670-128422692 AATCCTAGGCAGACAGGGGCAGG - Intergenic
938787830 2:134648506-134648528 AATTCTGGGCAGAAGAGGGTGGG - Intronic
940173182 2:150850353-150850375 AATCCTAGGCAGATGGGGGTGGG - Intergenic
940418985 2:153456241-153456263 CACTCTAGGCAGAAAAGGGCGGG - Intergenic
941427647 2:165368459-165368481 AATTCTGGGCAGAAGAGGACGGG - Intronic
941978411 2:171430699-171430721 AATCCTAGGCAGATGGGGGTGGG + Intronic
942183894 2:173406056-173406078 AATTCAAGGCAAAACAGGGCAGG - Intergenic
943474838 2:188341136-188341158 AATTCTAGGCAGAAAAGGTCAGG - Intronic
944067455 2:195633951-195633973 AATTCTAGGCAGAAAAGGGCAGG - Intronic
944199443 2:197090585-197090607 AATTCTAGGCAGAAAAGGGCAGG + Intronic
944315860 2:198285233-198285255 CATTCTAGGAAGAAGTCTGCAGG - Intronic
944454472 2:199878856-199878878 AATTCTTAGCAGAAGAGGGTGGG - Intergenic
944586640 2:201178869-201178891 AATGGGAGGCAGAAGGGGGCAGG + Intergenic
944594262 2:201246898-201246920 AATTTTAGGAAGAAGTTGTCTGG + Intronic
944891135 2:204118154-204118176 AATTCTAGGCAGAAAAGGAAGGG - Intergenic
946216009 2:218184092-218184114 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
946412422 2:219522010-219522032 TTTTCTAGGAAGAGGTGGGCAGG + Intronic
946563561 2:220939792-220939814 AATTCTAGGCAGGCAGGGGCGGG + Intergenic
947227347 2:227853121-227853143 AATTCTAGGTAGACAGGGGCAGG - Intergenic
1168949050 20:1783968-1783990 ACTTGGAGGCAGCAGTGGGCTGG + Intergenic
1170427429 20:16248813-16248835 AAAACCAGGGAGAAGTGGGCAGG - Intergenic
1171286564 20:23944127-23944149 AGATCTAGGGAGGAGTGGGCAGG - Intergenic
1172676664 20:36677286-36677308 AGTCCTGGGCAGAAGGGGGCAGG + Intronic
1176695551 21:9972797-9972819 AATTCTGGGCAAAAGAGGGCAGG - Intergenic
1177124621 21:17181204-17181226 AATTCTGGGTAGAAGAGGGCAGG + Intergenic
1177281373 21:18986998-18987020 AATTCTAGGCAAAAAACGGCAGG + Intergenic
1177555065 21:22678702-22678724 AATTCTAGACAGAAAAGGGCAGG + Intergenic
1177703782 21:24674185-24674207 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1177968408 21:27758724-27758746 AATTCTAGGCAGACAGGGGCAGG + Intergenic
1178031757 21:28535599-28535621 AAGTCTTGGCAGAAGTTAGCTGG + Intergenic
1178223628 21:30689397-30689419 CATTCTGGGCAGAAGAGGGCAGG + Intergenic
1178447310 21:32658086-32658108 AATTCTGGGCAGAAGTGGGTGGG + Intronic
1179110253 21:38439957-38439979 TATTCTAGGCAGAAGGAGGTGGG + Intronic
1183860375 22:40665566-40665588 AACATTAGGCAGAAGTGGCCAGG - Intergenic
1184369427 22:44073191-44073213 ATTTAAAGTCAGAAGTGGGCTGG + Intronic
1184906640 22:47491878-47491900 GATTCCAGGCAGAACTGGACAGG + Intergenic
1185046822 22:48532752-48532774 GATTTCAGGCAGAAGTGGCCCGG - Intronic
949227462 3:1711545-1711567 GATTCTAGGCAGACAAGGGCAGG - Intergenic
949258697 3:2081222-2081244 AATTCTAGGCAGACAGGGGTGGG + Intergenic
949664835 3:6325785-6325807 AATTCAATGCAGAATTGAGCAGG + Intergenic
949956708 3:9275060-9275082 AACTCTGGGCAGAAGAGGGCAGG - Intronic
950254540 3:11493548-11493570 AACTCTAGGCAGACAGGGGCAGG - Intronic
950758786 3:15202133-15202155 AATTTTAGGAAGAAGTGAGTTGG - Intergenic
950978857 3:17280313-17280335 AATTCTGGACAGAAGAGGGCAGG + Intronic
950997410 3:17518156-17518178 AATTCTAAGCAGAAAAGGGTGGG + Intronic
951082437 3:18467851-18467873 ACTTCTAGGCTGATGTGGGCTGG + Intergenic
951238607 3:20264561-20264583 AATTCTAGTCAGACAGGGGCAGG + Intergenic
951251096 3:20395215-20395237 AATTCTGGGAAGAAGAGGGCAGG + Intergenic
951931697 3:27974270-27974292 AATTCTAGGCAGAAAAGGGAGGG - Intergenic
952109716 3:30108773-30108795 AATACTGGGTAGAAGAGGGCGGG + Intergenic
952181401 3:30920396-30920418 AATTCTAGGCAGACAGGGGCAGG + Intergenic
954563594 3:51579401-51579423 AATTCTGGGCAGAAGAGGGCAGG - Intronic
955950416 3:64237727-64237749 AATACTAGGCAGAAAAGGGTGGG - Intronic
957244652 3:77702065-77702087 AATACTAGGCAGAAAAGGGTGGG + Intergenic
957414184 3:79879017-79879039 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
958023898 3:88028108-88028130 AACACTAGGCAGAAAGGGGCGGG + Intergenic
958119337 3:89263847-89263869 AATTCTAGGAAGAAAAGGGAGGG - Intronic
958467387 3:94474022-94474044 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
958996617 3:100913001-100913023 CAGTCTAGGCAGAGGCGGGCAGG + Intronic
959155647 3:102663715-102663737 AATACTAGGTAGAAAAGGGCAGG + Intergenic
959212735 3:103409746-103409768 CATTCTAGGCAGAAAGAGGCAGG + Intergenic
960420993 3:117444947-117444969 AATACTAGGTAGAAATGGGCGGG - Intergenic
962042873 3:131725422-131725444 AATTCTAGTCAGCAATGGGCTGG - Intronic
963409669 3:144911514-144911536 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
963410618 3:144922389-144922411 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
963858378 3:150280383-150280405 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
965542033 3:169880222-169880244 ATTCCTGGGCAGAAGGGGGCAGG + Intergenic
966059182 3:175734256-175734278 AAATCTAGGCAGAGGTGGGCTGG + Intronic
966830858 3:184007314-184007336 AAAAATAAGCAGAAGTGGGCCGG - Intronic
967627891 3:191707833-191707855 AATTCTAGCCAGCAAAGGGCAGG + Intergenic
969996673 4:11319457-11319479 AATTCTAGCAAGGAGGGGGCTGG + Intergenic
970131599 4:12877152-12877174 AATTCTAGGCAGAAAAAGGCAGG - Intergenic
971427422 4:26530226-26530248 AGTTCTGGGCAGACGAGGGCAGG + Intergenic
971959871 4:33471643-33471665 AATTCTAGGCAGACAGGGGTGGG - Intergenic
972066488 4:34952830-34952852 AATTCTAGGCAGACAAGGGCAGG + Intergenic
973022504 4:45220792-45220814 AATTCTAGGCAGACAGGGGCAGG - Intergenic
973954719 4:56050736-56050758 ACTTCAACTCAGAAGTGGGCAGG + Intergenic
974505850 4:62771606-62771628 AATTCTAGTCAGAAAAGGGTAGG + Intergenic
975380060 4:73689802-73689824 AAGTCTAGGCAGAACTTGGTAGG + Intergenic
975387091 4:73770321-73770343 AATTCTAGGTAAAAAAGGGCAGG + Intergenic
975947430 4:79724320-79724342 AATTCTATGCAGAAAAGGGCGGG - Intergenic
976031411 4:80758566-80758588 AATTCTGGGCAGAAGAGAGTGGG - Intronic
976042092 4:80898601-80898623 AATTCTGGGAAGAAGAGGGTGGG - Intronic
976462893 4:85333452-85333474 ATTTCCAGGCAGAGGTGAGCAGG - Intergenic
976883656 4:89960801-89960823 AATTCTAGGCAGAAAGGGCAGGG - Intergenic
977338757 4:95730420-95730442 AATTCTAGGCATAAAAGGGCAGG - Intergenic
977364910 4:96056018-96056040 AATTCTAGGTAGAAAAGTGCAGG + Intergenic
977672845 4:99716015-99716037 AATTTTGGGCAGAAGGGGGCAGG + Intergenic
977781396 4:100985703-100985725 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
977827549 4:101551698-101551720 AATTCTGGGCAGAAGAGGGCAGG + Intronic
978593833 4:110355775-110355797 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
979184315 4:117770130-117770152 AATTCTAAGCAGAAAAGGGCAGG + Intergenic
979596565 4:122541472-122541494 AATTCTGTGCAGAAGAGGGTGGG + Intergenic
979874891 4:125876206-125876228 AATTCAAGGCAGATTTGAGCAGG + Intergenic
979946759 4:126842862-126842884 AATTCTAGGCAGATAGGGGCAGG + Intergenic
980299654 4:130972595-130972617 AATTCTAGACAGACATGGGTGGG + Intergenic
980368177 4:131833045-131833067 AATTCTGGGCAAAAGAGGGCAGG - Intergenic
980492982 4:133553135-133553157 AATTCTAGGCAGAAAAGGCAGGG - Intergenic
980495395 4:133584059-133584081 AATTCTGGGCAGAAGAGGATGGG + Intergenic
980680701 4:136155791-136155813 AATTCTAGGCAGACAGGGCCTGG - Intergenic
982611037 4:157574775-157574797 GCGCCTAGGCAGAAGTGGGCGGG + Intergenic
982786678 4:159544392-159544414 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
982798536 4:159673797-159673819 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
983347663 4:166546965-166546987 ATGTCTAGGCAGAAAGGGGCAGG - Intergenic
983351932 4:166601601-166601623 AATCCTAGACAGAAAGGGGCGGG + Intergenic
983462700 4:168047432-168047454 AATTCCAGGCAGAAAAGGGCAGG - Intergenic
983693145 4:170497155-170497177 TATTTTAGGCTGAAGTGTGCGGG + Intergenic
983697927 4:170554989-170555011 AATTCTAGGCAGACAGGGGCAGG - Intergenic
983987233 4:174073868-174073890 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
984129602 4:175857009-175857031 AATACTGGGTAGAAGAGGGCAGG - Intronic
985048960 4:185970692-185970714 AATTCTAGGCAGAAGAGGGCAGG - Intergenic
985709416 5:1419927-1419949 AACCCAAGGCAGAAGTGGGAAGG - Intronic
986076251 5:4340795-4340817 AATTCTAGGCAGACAGGGACCGG - Intergenic
986164804 5:5264269-5264291 AATCCTAGGCAGACAGGGGCAGG - Intronic
986216383 5:5723209-5723231 AATTCTATGCACAAGTTAGCTGG - Intergenic
987268222 5:16278357-16278379 AATACTGGGTAGAAGAGGGCCGG + Intergenic
987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG + Intronic
988231413 5:28484152-28484174 AATTCTGGGCAGAAGAGAGTGGG - Intergenic
988350861 5:30106028-30106050 AATTCTGGGCTGAAGAGGGCAGG + Intergenic
988603635 5:32662027-32662049 AACTCTAGGCAGACAGGGGCAGG - Intergenic
988635345 5:32977798-32977820 AATACTGGGTAGAAGAGGGCAGG + Intergenic
988940372 5:36139433-36139455 GCTCCTGGGCAGAAGTGGGCAGG + Intronic
990176597 5:53114809-53114831 AATTTTAGGCAGAAAAGGGAGGG - Intergenic
990293402 5:54378139-54378161 AATTCTAGGCAGACAGGGGCAGG + Intergenic
990463083 5:56047620-56047642 AATACTGGGTAGAAGAGGGCAGG + Intergenic
991219633 5:64198567-64198589 AATTTCAGGGAGAAGAGGGCAGG + Intronic
993132312 5:83914390-83914412 CATTCTTGGCTGGAGTGGGCAGG - Intergenic
993404840 5:87499117-87499139 AATTCTAGGCAGACAGGAGCAGG + Intergenic
994188135 5:96838174-96838196 AATTCTGGGCAGAAGAGGGCAGG - Intronic
994775215 5:104031016-104031038 AATTCTAGGCAGAAAAGGAAAGG + Intergenic
994830479 5:104775222-104775244 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
994980417 5:106867955-106867977 AATTCTAGGAAGAACTGAGTTGG - Intergenic
995420580 5:111962534-111962556 AATCCTAGGCAGACAGGGGCAGG + Intronic
996101565 5:119450323-119450345 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
996234476 5:121108806-121108828 AGTCCTAGGCAGAAGGGGGTGGG - Intergenic
996242010 5:121215596-121215618 AATACTGGGTAGAAGAGGGCAGG + Intergenic
996502207 5:124229958-124229980 AATTCTGGGCAGAAGAGGGCGGG + Intergenic
996650808 5:125873713-125873735 AATTCTGGGCAGAAGAAGGTGGG - Intergenic
997332029 5:133071034-133071056 AAATACAGGAAGAAGTGGGCAGG - Intronic
997695657 5:135858767-135858789 AACTTTAGGGAGAAGTGAGCTGG + Intronic
997695934 5:135860737-135860759 ATTTCTAGGCAGCCTTGGGCAGG + Intronic
998644040 5:144042525-144042547 AATTCTGGGCAGAAGAGGGAGGG - Intergenic
999851177 5:155541365-155541387 AATTCTAGGCAGAAGAGGACGGG + Intergenic
1000233401 5:159335966-159335988 AATTCTAGGCAGAAAAGAGTGGG + Intergenic
1000234504 5:159344889-159344911 AATACTGGGTAGAAGAGGGCAGG - Intergenic
1000845915 5:166280261-166280283 AATTCTAGGCAGAAAAGGGTAGG + Intergenic
1001969633 5:175944112-175944134 AATTCCAGGCAGAAAAGGGCAGG - Intronic
1002247801 5:177899641-177899663 AATTCCAGGCAGAAAAGGGCAGG + Intergenic
1002661516 5:180793616-180793638 AATTCAAAGCAGAAGTGGAAAGG + Intronic
1004495192 6:16156307-16156329 AATTCTGGGCAGAAGAGGTCGGG - Intergenic
1004977564 6:20984935-20984957 AATTCTGGGTAGAAAAGGGCAGG - Intronic
1007931985 6:45700019-45700041 AATACTGGGCAGAAGAGGGCAGG + Intergenic
1008215535 6:48783248-48783270 AATTCTAGGCAGAAAAAGGTGGG - Intergenic
1008236515 6:49057819-49057841 AAATCTAGGCAGAAGTTGACAGG + Intergenic
1008255826 6:49298169-49298191 AATTCTGGGCAGAAGAAGGCGGG - Intergenic
1008430183 6:51407134-51407156 AATTGTAGTCAGATGTTGGCTGG - Intergenic
1008516708 6:52325607-52325629 AATTAAAGGCTGAGGTGGGCCGG + Intergenic
1009046869 6:58244487-58244509 AAATCTAGCCAGAGGGGGGCGGG + Intergenic
1009524723 6:64729203-64729225 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1009665136 6:66668520-66668542 AATTGTAGGCAGTAGTGTACAGG - Intergenic
1010294664 6:74182373-74182395 AATTCTAGGCAGACAGGGGTAGG + Intergenic
1010397017 6:75404342-75404364 AGATCTTGGGAGAAGTGGGCAGG - Intronic
1010584540 6:77642120-77642142 AATTCTAGGCAGAAAAGGGTGGG - Intergenic
1010643923 6:78364458-78364480 AAATCTAGGCAGACAGGGGCAGG + Intergenic
1010736547 6:79450343-79450365 AATTCTAGGAAGAAAAGGGCAGG + Intergenic
1011408740 6:87043875-87043897 AATTTTAGGCAGACAGGGGCGGG + Intergenic
1011493466 6:87916208-87916230 AATTCTGGGCAGGAAAGGGCGGG + Intergenic
1011899590 6:92275431-92275453 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1012843121 6:104355677-104355699 AATTCTAGGCAGAAAAGTGTGGG + Intergenic
1012914106 6:105149874-105149896 AGTTCTAGGCTGCAGTGAGCCGG + Intergenic
1013492396 6:110660931-110660953 AATTCTGGGCAGAAGAGGGTGGG - Intronic
1013995666 6:116304775-116304797 CATTCTAGGCAGATGAGGGCTGG - Intronic
1014252267 6:119127177-119127199 AATTCTAGGCATAAAAGGGTGGG - Intronic
1014883059 6:126746522-126746544 ATGTCTAGGCAGAAGTTTGCTGG - Intergenic
1016084447 6:139895212-139895234 AATTCTAGGTAGACAGGGGCTGG - Intergenic
1016538652 6:145138022-145138044 AATACTAGGGAGAGATGGGCTGG - Intergenic
1016549009 6:145255870-145255892 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
1017049085 6:150373718-150373740 AATTTTTGGCAGTGGTGGGCTGG - Intronic
1017584804 6:155909063-155909085 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
1017683291 6:156885840-156885862 AGTTCTAGGCACAAGTGGGAAGG - Intronic
1017693867 6:156994753-156994775 AATCCTAGGCAGCCCTGGGCTGG - Intronic
1017998965 6:159561260-159561282 AATTCTAGGCAGAAGGGGGCGGG - Intergenic
1019042263 6:169117148-169117170 AATTCTAGGCAGAAAAGGACAGG + Intergenic
1019043405 6:169124717-169124739 AATTCTAGGCAGAAAAGGGTGGG + Intergenic
1020284169 7:6667496-6667518 AATTCTGGGCAGAAGAGGGCGGG + Intergenic
1020739133 7:11990702-11990724 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1022031722 7:26498029-26498051 AAGTCTAGGCAGTGGTGTGCTGG - Intergenic
1022263382 7:28729294-28729316 AATTCTAGGTAGAAATGTGAAGG - Intronic
1022539575 7:31123440-31123462 AATTGTCTGCAGAAGAGGGCAGG - Intergenic
1022563037 7:31369619-31369641 AGTTCTAGGCAGAAAAGGGCAGG - Intergenic
1022591758 7:31670680-31670702 AATTCTGGGCAGAAGAGAGCAGG + Intergenic
1022679678 7:32532430-32532452 TATTCTAGGCAGAAAAGGGTGGG - Intronic
1024808914 7:53184281-53184303 AATTCTAGGCAGAAAAGGGCGGG + Intergenic
1025060285 7:55799569-55799591 AATTATAGGCAAAAGAGGACAGG + Intronic
1025936117 7:66038842-66038864 ACTACTTGGCAGAAGTGGACAGG + Intergenic
1026280963 7:68921498-68921520 AATTCTAGGCAGAAGAGGGTGGG + Intergenic
1026919449 7:74144463-74144485 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
1028501192 7:91520648-91520670 AATTCTGGGAAGAAGAGGGTGGG + Intergenic
1029608665 7:101615023-101615045 AATTGCAGGCAGGAGTGGGCGGG - Intronic
1029946568 7:104539515-104539537 ATTTCCAGGCAGAAATGGGTGGG + Intronic
1030065522 7:105656086-105656108 AGTTGTAGGCTGAGGTGGGCAGG - Intronic
1030546933 7:110907615-110907637 AATTCTGGGCAGAAGAGGGTGGG - Intronic
1030642358 7:112020956-112020978 AACTCTGGGGAGAAATGGGCAGG - Intronic
1031063472 7:117077355-117077377 AATTCTAGACAGAAAAGGGCAGG - Intronic
1031116336 7:117673038-117673060 AATTCTAGGCAGAAAAGGGCGGG + Intronic
1031696123 7:124857347-124857369 AATTCTACGCAGAAGAGGGCAGG + Intronic
1031843178 7:126772028-126772050 AATTTTAGGCAGAAGTGGAAAGG - Intronic
1032248426 7:130232432-130232454 AATTCTGGGCAGAAAAGGGCAGG - Intergenic
1032797591 7:135290207-135290229 AATTCTAGGCAGAAAAGGGCAGG + Intergenic
1032917639 7:136510170-136510192 AATTCTAGGCAGAAAAGGATGGG - Intergenic
1034093036 7:148381742-148381764 AAATCTAGGCAGAAAGGGGCGGG - Intronic
1037258489 8:16981609-16981631 AATTCTAGGCAGAAAAGGGTGGG + Intergenic
1037331428 8:17747482-17747504 AATTCTAGGCAGACGGGGGCAGG + Intronic
1037427447 8:18771292-18771314 AATTCTGGGCAGAAGAGGATGGG - Intronic
1038239466 8:25795372-25795394 ATTTACATGCAGAAGTGGGCAGG + Intergenic
1038369114 8:26970042-26970064 AATTATGGGCAGAAGAGGGTGGG - Intergenic
1038957560 8:32483807-32483829 AAGTTTGGGCAGAAGTGGCCAGG + Intronic
1039076330 8:33693461-33693483 AATTCTAGGCAGGCAGGGGCAGG + Intergenic
1039513597 8:38111680-38111702 AAATCTAAGAAGAAATGGGCCGG - Intronic
1039645567 8:39278395-39278417 AATTCTAGGCAGAAAAGGGTGGG - Intronic
1039661305 8:39470506-39470528 AATCCTAGGCAGAAGAGGGTGGG + Intergenic
1039661835 8:39476737-39476759 CATTGTAGGGAGAATTGGGCAGG - Intergenic
1039679129 8:39709528-39709550 AATTTTAGGCAGAAAAAGGCAGG - Intronic
1040663626 8:49604517-49604539 AATTCTAGGCAGACAGGGGTGGG + Intergenic
1040908349 8:52491876-52491898 AATTCTAGGCAGAAAAGGGTGGG - Intergenic
1042004359 8:64165247-64165269 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
1042081517 8:65059582-65059604 AATCCTAGGCAGAAAAGGGAGGG + Intergenic
1042445955 8:68885191-68885213 AATTCTAGGCAGAAGAGGGCAGG - Intergenic
1043220399 8:77655485-77655507 AATCCTGGGTAGAAGTGGGCAGG + Intergenic
1043701397 8:83292234-83292256 AATTCTAGGCACAAAAGGGCAGG - Intergenic
1044274724 8:90286028-90286050 AACTCTGGGCAGAAGAGGCCAGG - Intergenic
1044286876 8:90420098-90420120 AATTCTGGGCAGAAGAGTGTGGG - Intergenic
1044631076 8:94279020-94279042 AATTCTAGGCAGACACGGGTGGG - Intergenic
1044741875 8:95335935-95335957 AATTCTGGGCTGAGCTGGGCAGG - Intergenic
1045211569 8:100105565-100105587 AATTCAAGGTGGAAGTGGGAAGG + Intronic
1045762592 8:105628411-105628433 AATTCTAGGCAGAAAAGGGTGGG + Intronic
1048800351 8:138188928-138188950 AATTCTGGGCAGAAGAGGGAAGG + Intronic
1050761002 9:9070981-9071003 AATTCGAGGCTGCAGTGAGCTGG - Intronic
1050819222 9:9856401-9856423 AATTCTAGGCAGAAAAGGATGGG - Intronic
1050944348 9:11499028-11499050 AATTCTGGGCAGAAGAGGACAGG + Intergenic
1050990848 9:12149700-12149722 AATTCTGGGCAGAAGAGAGTAGG - Intergenic
1052122234 9:24731555-24731577 AATTCTAGGCAGATGGGGGTGGG - Intergenic
1052216384 9:25971780-25971802 AATTCTAGGCAGACAGGGGTCGG + Intergenic
1052518746 9:29515155-29515177 CGTTCTAGGCAGAAAAGGGCAGG - Intergenic
1052540487 9:29805000-29805022 AATTCAGGGCAGAAAAGGGCAGG - Intergenic
1052593706 9:30531561-30531583 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1053014147 9:34652256-34652278 AAGTCTTGTCAGGAGTGGGCGGG + Intronic
1053115670 9:35499576-35499598 AACTTTAGCCAGAAGTTGGCTGG - Intronic
1053545418 9:39018138-39018160 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1053632534 9:39958748-39958770 AATTCTGGGCAAAAGAGGGCAGG - Intergenic
1053773226 9:41504783-41504805 AATTCTGGGCAAAAGAGGGCAGG + Intergenic
1053809748 9:41839836-41839858 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1054211354 9:62291949-62291971 AATTCTGGGCAAAAGAGGGCAGG + Intergenic
1054313629 9:63556903-63556925 AATTCTGGGCAAAAGAGGGCAGG - Intergenic
1054620845 9:67347592-67347614 AATTCTGGGCAGAAGAGGGTGGG + Intergenic
1055240831 9:74183700-74183722 AGTTCTCAGCAGAAGAGGGCAGG - Intergenic
1055375519 9:75645490-75645512 ATTTCTAGGCAGAAAAGGGTGGG - Intergenic
1055376171 9:75649750-75649772 TATTCTAGGCAGAAAAGGGTGGG - Intergenic
1055478266 9:76685045-76685067 AATAAGAGGCAGAAGTGGCCGGG - Intronic
1055708525 9:79034220-79034242 AATTCTAGGCAGACAGGGACAGG - Intergenic
1056059511 9:82869851-82869873 CATTCTAGGCAGACAGGGGCAGG + Intergenic
1056427067 9:86488212-86488234 AACTCTGGGCAGAAGAGGGTGGG + Intergenic
1056758525 9:89398036-89398058 AAGTCTAGGCAGACAGGGGCAGG + Intronic
1057147549 9:92768398-92768420 AATTCCAGGTAGAAAAGGGCGGG - Intergenic
1058120781 9:101136215-101136237 GATTCTAGAGGGAAGTGGGCTGG - Intronic
1058809764 9:108628072-108628094 AATTGTAGGGAGAAGTGAGAGGG - Intergenic
1058827981 9:108792251-108792273 AATTCTAGGCAGACAGGGTCAGG + Intergenic
1058829210 9:108800282-108800304 AATTCTAGGCAGACAGGGGTGGG + Intergenic
1061075096 9:128336376-128336398 GTTTCTAGGCAGAAGTTGGTAGG - Intergenic
1061182262 9:129031631-129031653 AATACTAGGCAGACAGGGGCGGG + Intergenic
1061517777 9:131099438-131099460 GATTGTAGGCAGAATTGTGCTGG + Intronic
1185983472 X:4805267-4805289 AATTATCCTCAGAAGTGGGCTGG + Intergenic
1186033268 X:5392613-5392635 AATTCTGGGCAGAAGAGGGTGGG - Intergenic
1186087095 X:6002626-6002648 AATTCTGGGCAGAAGAGAGCGGG + Intronic
1186127157 X:6426333-6426355 AATTCTGGGCAGAAAAGGGAGGG - Intergenic
1186128674 X:6443089-6443111 AATTCTGGGCAGAAGAGGGCGGG - Intergenic
1186223200 X:7371434-7371456 AATTCTAGGCAGAAGGTGGTAGG + Intergenic
1187809820 X:23163290-23163312 AAAGCTGGACAGAAGTGGGCTGG + Intergenic
1188116743 X:26254124-26254146 AATTCTGGGCAGAAGAGTGTAGG + Intergenic
1188125510 X:26363425-26363447 AATTCTGGTCATAAGAGGGCAGG - Intergenic
1188182350 X:27072261-27072283 AATTCTGGGCACAAGAGGGCAGG + Intergenic
1188527060 X:31098085-31098107 AATTCTAGGCAGACAAGGGTGGG - Intronic
1188553206 X:31383503-31383525 AATTCTGGACAGAAGAGGGCGGG + Intronic
1188554841 X:31399566-31399588 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1189675086 X:43453179-43453201 AATTCTGGGCAGAAGAGGATGGG - Intergenic
1190531804 X:51386170-51386192 ATGTCTAGGCAGAAGTTTGCTGG - Intergenic
1190598554 X:52068305-52068327 AATATTAGGCAGTAGGGGGCGGG + Intronic
1190610270 X:52185768-52185790 AATATTAGGCAGTAGGGGGCGGG - Intronic
1191057306 X:56254966-56254988 AATTCTAGGCAGAAGTGGGCAGG - Intronic
1191767166 X:64710347-64710369 AATACTAGGTAGAAAAGGGCAGG - Intergenic
1193809926 X:86039595-86039617 AATTCTAGGCAGAAAAGGGCAGG + Intronic
1194176257 X:90651714-90651736 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1194690706 X:96980601-96980623 AGCTCTAGGCAGAAAAGGGCAGG - Intronic
1194878902 X:99225636-99225658 AATTCCTGGCAGAAGAGGGCAGG + Intergenic
1195179095 X:102339557-102339579 GTTTCTAGGCAGAAGGGGGTGGG - Intergenic
1195721346 X:107871994-107872016 AATTCTGGGCAGAAGAGGATAGG - Intronic
1195722510 X:107879678-107879700 AATTCTGGGCAGAAGAGAGTGGG - Intronic
1195853274 X:109305862-109305884 AATTCTAGGCAGATAGCGGCAGG - Intergenic
1195854136 X:109311801-109311823 AATTCTAGGCAGACAGGGGTGGG - Intergenic
1195858711 X:109358195-109358217 AATTCTAGACAGAAAAGGGAGGG + Intergenic
1196300713 X:114047411-114047433 AATTTTGGGCAGAAGAGGGCAGG + Intergenic
1196395962 X:115261814-115261836 AATTCTGGGCAGAAGAGAGCAGG - Intergenic
1197340751 X:125263641-125263663 AATTCTAGGCAGAAAAGGATGGG - Intergenic
1199211346 X:145215017-145215039 ATTCCTAGGCAGATATGGGCGGG - Intergenic
1199219947 X:145306252-145306274 AATTCTAGGCAGAAAATGGTGGG - Intergenic
1199336996 X:146630165-146630187 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1199861130 X:151801279-151801301 ATTCCTGGGCAGAAGGGGGCGGG - Intergenic
1200522882 Y:4232659-4232681 AATTCTAGGCAGAAAAGGGCAGG - Intergenic
1201592759 Y:15633703-15633725 AATTCCAGGCAGAAGGTGGAAGG + Intergenic
1201639109 Y:16159966-16159988 AATTCTGGGTAGAAGAGGGTGGG + Intergenic
1201663704 Y:16425361-16425383 AATTCTGGGTAGAAGAGGGTGGG - Intergenic