ID: 1191059507

View in Genome Browser
Species Human (GRCh38)
Location X:56279694-56279716
Sequence CAGTGGAGATGGAGAGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1425
Summary {0: 2, 1: 6, 2: 27, 3: 166, 4: 1224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191059502_1191059507 15 Left 1191059502 X:56279656-56279678 CCAGGCAAAAAATGATGACAGCT 0: 1
1: 2
2: 0
3: 51
4: 274
Right 1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG 0: 2
1: 6
2: 27
3: 166
4: 1224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191059507 Original CRISPR CAGTGGAGATGGAGAGAAGG AGG Intronic
900037136 1:423881-423903 TAGTGGAAATAGAGATAAGGAGG + Intergenic
900058766 1:659622-659644 TAGTGGAAATAGAGATAAGGAGG + Intergenic
900315782 1:2055704-2055726 CAGTGGGGATGGTGGGAAAGAGG + Intronic
900512042 1:3065379-3065401 CAGAGGAGTGGGAGAGAAAGGGG + Intergenic
900760026 1:4464120-4464142 CAGTGGGGTTGGAGGGAAGGAGG - Intergenic
900977896 1:6028538-6028560 CAGAAGGGATGGAGAGAGGGGGG - Intronic
900993466 1:6108299-6108321 GAGGGAAGATGGAGAGACGGAGG + Intronic
901105119 1:6749412-6749434 AAGAGGAGAAGGAGAAAAGGAGG - Intergenic
901203583 1:7481082-7481104 CAGAAGAGAGGGAGAGAAGGAGG - Intronic
901267854 1:7925809-7925831 GATGGGAGATGGAGATAAGGCGG + Intronic
901428328 1:9197680-9197702 GACTGGAGAGGGAGAGGAGGAGG - Intergenic
901635346 1:10667856-10667878 CAGCCGAGATGGGGAGAAGGTGG - Intronic
901855134 1:12039573-12039595 CAGTGGAGAAGGGGAGAGGGAGG + Intergenic
901922836 1:12548651-12548673 CATTGGAGAGGGAGGGAGGGAGG + Intergenic
902373600 1:16019751-16019773 GAGGTGAGATGGAGAGAGGGTGG + Intronic
902384696 1:16069629-16069651 CCCTGGAACTGGAGAGAAGGGGG + Intronic
902435397 1:16395319-16395341 CAGTGGGAAGGGGGAGAAGGGGG - Exonic
902589043 1:17460429-17460451 CAATTGGGATGCAGAGAAGGAGG - Intergenic
902997801 1:20240487-20240509 GAGTGGATATGGAGAGAATTGGG + Intergenic
903539773 1:24090344-24090366 AAGTGGAGACAGAGAGGAGGAGG + Intronic
903721496 1:25408877-25408899 GTGGGGAGATGGTGAGAAGGAGG + Intronic
904183909 1:28687724-28687746 CAGTGGAGATAGAGACAGGGAGG + Intronic
904753531 1:32755311-32755333 CAGAGGAGGTGGAGTGAAGGGGG + Intronic
905030160 1:34876880-34876902 CAGTGGATACAGAGAGAAGTGGG - Intronic
905094404 1:35456841-35456863 AAGGAGAGATGGAGGGAAGGAGG + Intronic
905188475 1:36214411-36214433 CAGTGGGGATGAAGAAAAGTGGG - Intergenic
905337680 1:37256724-37256746 GAGGAGAGATGGAGAGAAGGAGG - Intergenic
905521759 1:38605777-38605799 CAGGGGGGCTGGAGAGGAGGTGG - Intergenic
905689844 1:39934944-39934966 GAGTGGAGATGGAAAGAATGAGG + Intergenic
905746512 1:40422932-40422954 CAGAGCAGATGGGGAGAGGGTGG - Exonic
905864669 1:41370284-41370306 CAGAGAAGAGGGAGAGAAGAGGG + Intronic
905869674 1:41396025-41396047 CAGTTCAGGTGGAGGGAAGGTGG - Intergenic
905921015 1:41718697-41718719 CAGGAGAGATGGAGAGAGGAGGG - Intronic
905945917 1:41901311-41901333 AAGTGGAGATGCTAAGAAGGGGG + Intronic
905972124 1:42150180-42150202 CAGTGGAGATGATGAGAAACGGG + Intergenic
906043567 1:42809085-42809107 CAGTGGTGATGGAAAGAAGATGG + Intronic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
906152538 1:43595994-43596016 CAGTGCCGCTGTAGAGAAGGAGG + Intronic
906246628 1:44280365-44280387 CAGTGGAAATGTAGAGAAATGGG - Intronic
906326594 1:44850041-44850063 CAGGGGTGGTGGAGGGAAGGTGG + Intergenic
906498449 1:46322304-46322326 CAGGAGGGATAGAGAGAAGGGGG + Intergenic
906536569 1:46554121-46554143 CAGTTGTGATGTAGAGAGGGAGG + Intergenic
906659374 1:47571689-47571711 GAGGGAAGAAGGAGAGAAGGAGG - Intergenic
906710549 1:47926672-47926694 CAGAGGGGTTGGAGAGAATGGGG + Intronic
906829227 1:49014114-49014136 ATGTGCACATGGAGAGAAGGGGG - Intronic
907080679 1:51618358-51618380 CATTCGATATGGAGAGTAGGTGG + Intronic
907093684 1:51754067-51754089 CAGTGGAGCTGGGGAGTAAGGGG + Intronic
907342063 1:53742248-53742270 TAGTGAGGATGGAGAGGAGGAGG - Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907794836 1:57706240-57706262 AAGTAGAGAAAGAGAGAAGGAGG - Intronic
907853767 1:58281428-58281450 TAGTGGAGATGGAGAGATATAGG - Intronic
907901565 1:58746303-58746325 TGGTGGACATGGAGAGAAGGGGG - Intergenic
908241742 1:62194499-62194521 CTGTGGAGTTGGAGAGACGCCGG + Intergenic
908522227 1:64955515-64955537 CAGTGTAGAAGGAGAGAAATAGG + Intronic
908690926 1:66779633-66779655 CAGAGGAGAGAGAGAGCAGGAGG - Intergenic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909418318 1:75433034-75433056 CAGTGCAGAGGGAGAGACTGAGG - Intronic
909756055 1:79227442-79227464 TAGCGGTGATGGAGAGGAGGTGG - Intergenic
909845663 1:80390725-80390747 AAGGGGAGATAGAGAGAAGTTGG + Intergenic
910064409 1:83136000-83136022 TAGTGGAGTTGCAGAGAATGGGG - Intergenic
910089479 1:83445405-83445427 CAGTAAAAATGGAGAGGAGGAGG + Intergenic
910090047 1:83451475-83451497 CAAAGGAGAAGAAGAGAAGGAGG - Intergenic
910520083 1:88110891-88110913 CAGTGGAAATGGACAGGAAGTGG - Intergenic
910693827 1:89991628-89991650 CAGTGGGGATGAAGAGGAGGGGG + Intergenic
911251905 1:95585895-95585917 AAATGAAGATGGAGAGGAGGGGG - Intergenic
911593079 1:99770176-99770198 CAGTGGAGATGGAGAAGAGGGGG - Intergenic
911688930 1:100809102-100809124 CAGTGGGGATGCAGAGCAGTGGG + Intergenic
911825152 1:102474028-102474050 CAGTGGGGATAGAGAGAGGAAGG - Intergenic
912204476 1:107494800-107494822 AAGGGGAGATGGAGTGAAGAGGG - Intergenic
912348150 1:108985014-108985036 CAGTGGAGGTGGAGCAAAGTGGG - Intronic
912451555 1:109770583-109770605 CAGAAGAGAGGGAAAGAAGGAGG - Intronic
912483394 1:110003498-110003520 GAGTGGGGATGGAGGGTAGGGGG + Intronic
912499078 1:110110027-110110049 CAGTGGGGATGCAGAGGAGGAGG + Intergenic
912552519 1:110493359-110493381 CAGAGGAGTTGGAGAGGAGTTGG - Intergenic
912614140 1:111080030-111080052 TAGTGGAAAGGGGGAGAAGGAGG - Intergenic
912661964 1:111539679-111539701 CAGTGGAGACTGGGAGTAGGGGG - Intronic
912717052 1:111990096-111990118 CAGTGGAGGAAGAGAGGAGGAGG + Intergenic
912772071 1:112473187-112473209 CAGGAGAGAGGGAGGGAAGGAGG + Intronic
912813453 1:112810974-112810996 CAGGCGAGAGGGAAAGAAGGAGG - Intergenic
912949933 1:114113681-114113703 CACTGGAGATGGAGAGAGGTGGG - Intronic
913274636 1:117124879-117124901 CAGTGGGGATGGAAAGAAATCGG - Intergenic
913613071 1:120527461-120527483 GAGTGGGGAGGGAGAGTAGGGGG + Intergenic
913693212 1:121299431-121299453 CAGTGGAGATGTATAAAAGGAGG - Intronic
914144343 1:144980648-144980670 CAGTGGAGATGTATAAAAGGAGG + Intronic
914353922 1:146865286-146865308 CAGGGGGGGTGGAGAGATGGTGG + Intergenic
914371421 1:147028199-147028221 GAGTGGGGAGGGAGAGTAGGGGG + Intergenic
914578115 1:148994788-148994810 GAGTGGGGAGGGAGAGTAGGGGG - Intronic
914939690 1:152011985-152012007 CAGGAGAGAGAGAGAGAAGGGGG + Intergenic
914984889 1:152448003-152448025 CAGAGGAGACAGAGAGAAGGTGG + Intergenic
915482402 1:156195868-156195890 GAGTAGAGGTGGAGAGGAGGAGG + Intronic
915491377 1:156251795-156251817 CAGAGCAGATGCAGAGGAGGGGG + Intronic
915566360 1:156715604-156715626 AAGTGGGGAAGGAGAGAAGTGGG - Intergenic
915574853 1:156768516-156768538 AAGTGAAGATGCAAAGAAGGGGG - Intronic
915673271 1:157508541-157508563 CAGTTGAGATGGGGTGATGGTGG - Intergenic
915727103 1:158025714-158025736 CAAAGGAGATGGAGAGGAGAGGG + Intronic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
915940906 1:160117674-160117696 CAGTGGAGATGCAGGGGAGAAGG - Intronic
916482244 1:165225010-165225032 AATTAGGGATGGAGAGAAGGAGG + Intronic
916489065 1:165285615-165285637 CAGTGGAGATGGTGAACAGCTGG - Intronic
916527310 1:165622814-165622836 CAGATGAGAGAGAGAGAAGGAGG - Intergenic
917063260 1:171063982-171064004 GAGGAGAGATGGAGAGAAGGGGG + Intronic
917081644 1:171261878-171261900 CACTGGGGAAGGAGAGAGGGTGG + Intronic
917161928 1:172067336-172067358 CAATGGAAATGGAGAAAAGTGGG - Intronic
917261037 1:173169753-173169775 CAGTGGGGATGAAGAGAGGTTGG + Intergenic
917965581 1:180176477-180176499 GGGGGGAGGTGGAGAGAAGGTGG + Intronic
918004244 1:180526769-180526791 CAGTGGTGTGGGAGAGAAGGGGG + Intergenic
918127346 1:181596108-181596130 CCGGGGAGATTGAGAGAAAGAGG + Intronic
918152056 1:181806086-181806108 CCTGGGAGATGGAGAGAAAGAGG + Intronic
918224936 1:182472649-182472671 CATAGAAGATGGAAAGAAGGTGG - Intronic
918319940 1:183354802-183354824 CTGTGGTGATTGAGAGAAGTAGG - Intronic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
918757940 1:188360421-188360443 CAGGAGAGATAGAGAGAGGGGGG - Intergenic
919367100 1:196675366-196675388 CGATAGAGATGGAGAGATGGAGG + Intronic
919483635 1:198119778-198119800 AGGTGGTTATGGAGAGAAGGAGG - Intergenic
919663434 1:200270004-200270026 CAGTGGAGGTAAAGAGAATGAGG + Intergenic
919664438 1:200278729-200278751 CAGTAGAGATAGAGAGAGGGAGG + Intergenic
919721240 1:200838822-200838844 CAGTTATGATGGAGAGAAGTTGG + Intronic
919856405 1:201709247-201709269 CACAGGAGATGGTGAGAAAGGGG + Intronic
919934652 1:202243577-202243599 CAGGGGAGGTGTAGAGCAGGAGG + Intronic
920106298 1:203555901-203555923 CAGGAGAGACGGAGAGGAGGGGG + Intergenic
920288814 1:204901856-204901878 CCGCGGTAATGGAGAGAAGGTGG + Intronic
920480536 1:206317801-206317823 CAGTGGAGATGTATAAAAGGAGG - Intronic
920622937 1:207566272-207566294 AAGGGGAGAAGGAGAGAAGAAGG - Intronic
920716759 1:208347332-208347354 CAGAGGAGATGGAGAACAGCTGG + Intergenic
920877152 1:209847367-209847389 GAGTGGGGATAGAGAGAAGATGG - Intronic
920965791 1:210699567-210699589 CAGAGAAGCTGGACAGAAGGTGG + Intronic
921409753 1:214823255-214823277 CAGTGGAGGTGGTGGGAGGGGGG + Intergenic
922468838 1:225862852-225862874 CTGTGGCCAGGGAGAGAAGGAGG + Intronic
922917988 1:229274134-229274156 CACTTGAGATGGGGAGATGGAGG - Intronic
922974202 1:229770090-229770112 AAGGGGAGATGGAGGGAGGGAGG - Intergenic
923275898 1:232396062-232396084 CAGTGAAAGTGGAGAGAAGTAGG - Intergenic
923399620 1:233603671-233603693 CTGTGGAGATGGCAAAAAGGTGG - Intergenic
923811015 1:237316007-237316029 GACTGGAGATGAAGAGATGGGGG + Intronic
923893473 1:238241466-238241488 ATGTGGAAATGGAGAGAATGGGG + Intergenic
923994050 1:239471632-239471654 CAGTGGGAGAGGAGAGAAGGGGG - Intronic
924444815 1:244119367-244119389 GAGAGGAGATGGAGGAAAGGAGG + Intergenic
924460548 1:244254858-244254880 CAGAGAGAATGGAGAGAAGGAGG - Intergenic
1062885370 10:1011924-1011946 CAGTGCAGAGGGTGAGACGGGGG - Intronic
1062916383 10:1243784-1243806 CAGTGGACATGGGCAGGAGGCGG - Intronic
1063330018 10:5148232-5148254 CATAGGAGATAGAGAGGAGGAGG + Intergenic
1063511228 10:6646974-6646996 AGGGGGAGAGGGAGAGAAGGAGG - Intergenic
1063524293 10:6770193-6770215 CAGTGGACAAGGGGACAAGGCGG - Intergenic
1063555030 10:7070211-7070233 TATTGGATATGGAGAGAAAGAGG + Intergenic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1063972474 10:11390853-11390875 CAATGGAGATAGAGAGTAGAAGG + Intergenic
1064321036 10:14304823-14304845 CAGTGGTGATGGGAAGATGGTGG + Intronic
1064325135 10:14343433-14343455 GAGGGGAGATGGAGAGGAGCTGG - Intronic
1064405548 10:15059124-15059146 AAGGGGAGAGGGAGGGAAGGGGG - Intronic
1064444644 10:15382764-15382786 CTGGGTAGATGGAGTGAAGGAGG - Intergenic
1064810247 10:19188855-19188877 CAGTAGAGATGGTCAGAAGTGGG + Intronic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065030653 10:21582655-21582677 TAGTGGAGATGGAGAGAGAGAGG + Intronic
1065106730 10:22396100-22396122 CAGGAGAGAGGGAGCGAAGGGGG + Intronic
1065204553 10:23344346-23344368 GAGTGGAGAGGGGGAGGAGGAGG + Intronic
1065667862 10:28082416-28082438 AGGAGGAGAAGGAGAGAAGGAGG - Intronic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1065765864 10:29028820-29028842 CAGTAGAGACAGAGTGAAGGGGG + Intergenic
1065874183 10:29982969-29982991 AAGGGGAGAGGGAGGGAAGGAGG + Intergenic
1066000431 10:31099813-31099835 CAGTGCAGTCGGAGAGACGGCGG - Intergenic
1066493510 10:35918170-35918192 CAGTGGAGTTGGAGATAGGCAGG + Intergenic
1066520999 10:36219073-36219095 CAGTGGAGATGCACATATGGAGG - Intergenic
1067278478 10:44854104-44854126 CAGTGGGCATGCAGAGGAGGTGG - Intergenic
1067314333 10:45147625-45147647 CAGTGAAGATGCAGATAAAGTGG + Intergenic
1067477359 10:46575854-46575876 CAGTGGAGAAGGAGGGTGGGAGG + Intergenic
1067511541 10:46898915-46898937 AAGGGGAGGTGGTGAGAAGGGGG + Intergenic
1067617381 10:47765930-47765952 CAGTGGAGAAGGAGGGTGGGAGG - Intergenic
1067650704 10:48152924-48152946 AAGGGGAGGTGGTGAGAAGGGGG - Intergenic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1068119568 10:52772026-52772048 AAGAGGACATGGAGAGAAAGAGG - Intergenic
1068585426 10:58792841-58792863 CAGGGGAGGGGGAGGGAAGGGGG - Intronic
1068714866 10:60177005-60177027 CAGTGGAGATGGTGAAATGTAGG - Intronic
1068764678 10:60750007-60750029 CAGTGGCTAAGGAGAGTAGGAGG + Intergenic
1069567185 10:69471575-69471597 AAGAGGGGAGGGAGAGAAGGTGG - Intronic
1069625463 10:69865186-69865208 CAGTACAGATGGAGAGAGAGAGG - Intronic
1069919859 10:71810025-71810047 CAGTGATGTTGGAGAGCAGGTGG - Exonic
1069938636 10:71937710-71937732 TAGTTGAAATGGAGAGAAGTGGG - Intergenic
1070236723 10:74635294-74635316 CAGTGGAGATCAAAAGAAAGTGG + Intronic
1070277567 10:75022063-75022085 CAGTGAAGAAGAAGAGGAGGAGG + Exonic
1070311342 10:75276053-75276075 CAGTGGAGAAGCAGAGCGGGGGG + Intergenic
1070448611 10:76534425-76534447 CAGTGGAAAGGGAAAGAATGTGG - Intronic
1070495293 10:77015836-77015858 GAGTGGAGGTGGAGAGAGGTGGG - Intronic
1070541805 10:77420817-77420839 AAGCTGAGATGGAGAGAAGTGGG - Intronic
1070573986 10:77663318-77663340 CTGTGGAGGAGGGGAGAAGGTGG - Intergenic
1070609087 10:77921285-77921307 CAGAGGGGATGAAGAAAAGGTGG + Intronic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1070726704 10:78796798-78796820 CAGCAGTGATGGACAGAAGGAGG + Intergenic
1071017484 10:81015070-81015092 CAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1071275353 10:84049114-84049136 GAGGGTAGAAGGAGAGAAGGAGG + Intergenic
1071292654 10:84198600-84198622 CTGTGGTGGTGGAGAGCAGGTGG - Intronic
1071675510 10:87652019-87652041 CGCTGGAGCTGGAGAGACGGTGG + Intergenic
1071849044 10:89550081-89550103 CAGTGCAGATGGAAAAAAAGGGG - Intronic
1072162789 10:92784020-92784042 CAGAGTAGAAAGAGAGAAGGAGG - Intergenic
1072310320 10:94148211-94148233 AAGTGGAGATGGAGCGAAGAAGG + Intronic
1072422848 10:95304024-95304046 CAGTGGAGATGTAGAGCAGGCGG + Intergenic
1072700286 10:97635966-97635988 CAGTGGAGATGAAAGAAAGGGGG + Intronic
1072737934 10:97891710-97891732 CAGTGGAGAAGGCCAGATGGAGG - Intronic
1073331678 10:102674142-102674164 AAGTGGAGACGGAGGGAGGGAGG + Exonic
1074296578 10:112194961-112194983 AGGTGGAGAGGGAGATAAGGGGG - Intronic
1074401201 10:113142337-113142359 AAGGGGAGAGGGAGGGAAGGTGG + Intronic
1074554282 10:114474233-114474255 CAGTAGAGAGGGAGAGAAATGGG - Intronic
1074695860 10:116049798-116049820 CGGGGGAGATGGAGGGATGGGGG + Intergenic
1074927556 10:118088753-118088775 CTTTGGAGATTCAGAGAAGGGGG - Intergenic
1075170139 10:120105680-120105702 CCCTGCAGATGAAGAGAAGGAGG + Intergenic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075361389 10:121838353-121838375 AGGTGGAGTTGGTGAGAAGGAGG - Intronic
1075651718 10:124131787-124131809 GAGTGGAGAGGGAGAAATGGTGG - Intergenic
1075730303 10:124631788-124631810 CAGTGAAGAGGGAGACAGGGCGG - Intronic
1075820381 10:125302958-125302980 TAGTGGAGATGAAGAAGAGGGGG - Intergenic
1075878487 10:125828105-125828127 CAATGGAGAGGGAGAGAAGTGGG + Intronic
1075993651 10:126859368-126859390 TAGTGGAGATGAAGAGGAAGAGG - Intergenic
1076444504 10:130503250-130503272 AAGGGGAGAAGGAGGGAAGGGGG - Intergenic
1076559184 10:131350015-131350037 CAGTGAAGGTGGTTAGAAGGAGG - Intergenic
1076593559 10:131609197-131609219 CACTGCAGATGGAGGGAGGGAGG - Intergenic
1076794387 10:132791563-132791585 CAGTGGAGCTGGGGGGAAGAGGG + Intergenic
1076963863 11:61803-61825 TAGTGGAAATAGAGATAAGGAGG + Intergenic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077139727 11:1018919-1018941 CAGGTGAGATGGAGACAATGGGG - Intronic
1077543483 11:3158672-3158694 CAGTGGTGCAGGAGAGAGGGAGG + Intronic
1078045043 11:7905959-7905981 CAATAGAGATAGTGAGAAGGTGG + Intergenic
1078280079 11:9892475-9892497 CAGAGGAAATGGGGTGAAGGTGG + Intronic
1078360519 11:10664290-10664312 GAGTGGAGATGAACAGGAGGCGG - Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078625428 11:12951528-12951550 ATGAGGAGATGGCGAGAAGGAGG + Intergenic
1078706442 11:13748312-13748334 CAGTGGTTAAGGAGAGCAGGAGG - Intergenic
1078831750 11:14984008-14984030 AAATGGAGAGGGAGTGAAGGAGG + Intronic
1078884665 11:15488491-15488513 CGGTGGAGGTGGCTAGAAGGAGG - Intergenic
1079161831 11:18002223-18002245 CAGTTGGGATGGAGAGTAAGAGG - Intronic
1079594766 11:22229121-22229143 GAGAGGACATGGAGAGAAGGTGG - Intronic
1079826455 11:25201186-25201208 AAGAGGAGAAGGAGGGAAGGAGG + Intergenic
1080049580 11:27845807-27845829 CTGTGGAGATTGAGAGAAAAAGG - Intergenic
1080056939 11:27916280-27916302 TAATGGAGATGGAAAGGAGGGGG + Intergenic
1080135084 11:28844759-28844781 AAGGAGAGAAGGAGAGAAGGAGG - Intergenic
1080770090 11:35332705-35332727 CAGGGCAGATGGGGAGAGGGAGG - Intronic
1080935832 11:36862470-36862492 CAGAAGAGATGGAGAAAAGTGGG - Intergenic
1081075938 11:38673753-38673775 AAGTTGAGAAGGAGAGAAGGTGG - Intergenic
1081207330 11:40291521-40291543 GGGTGGAGTTGGAGAGAAGTAGG + Intronic
1081334892 11:41852895-41852917 CCCTGGAGAAAGAGAGAAGGTGG + Intergenic
1081417868 11:42837335-42837357 CAGGAGAGAGAGAGAGAAGGGGG + Intergenic
1081477508 11:43449002-43449024 CAATGGGGATGGAGAAAAGTAGG - Intronic
1081604179 11:44517064-44517086 CAGTGGAGTGGGAGTGATGGGGG + Intergenic
1082653847 11:55828016-55828038 CAGTGGAGATGTTGACAAAGTGG + Exonic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083427905 11:62598459-62598481 CGTAGAAGATGGAGAGAAGGAGG - Intronic
1083612766 11:64011990-64012012 CAGTGGAGGTGGTGGGGAGGGGG - Intronic
1084101598 11:66953234-66953256 CTGCGGAGATGCAGAGAAAGCGG - Intronic
1084120773 11:67067687-67067709 CAGTGGGGGTGACGAGAAGGGGG + Intronic
1084461614 11:69299459-69299481 CAGGGGAGATGCAGAGGAGGGGG + Intronic
1084770902 11:71342283-71342305 CAGTGGAGAACGTGAGAAGTGGG + Intergenic
1085138918 11:74121884-74121906 CAGTGGAATTGGACAGGAGGTGG - Intronic
1085646348 11:78225776-78225798 CATGTGAGATGGAGACAAGGAGG + Intronic
1085719700 11:78902458-78902480 CAGCAGAGACGAAGAGAAGGTGG + Intronic
1085861314 11:80239265-80239287 GGGTGGTGAGGGAGAGAAGGAGG + Intergenic
1086101865 11:83109095-83109117 CAGTAGAGGTAGAGAGAAGTAGG + Intergenic
1086138063 11:83462612-83462634 GAGGGGAGATGAAGAGAAGCTGG + Intronic
1086162641 11:83739835-83739857 CAGTGCAGCTGGAGAGGAGCTGG + Intronic
1086168197 11:83804533-83804555 AAGTGGAGAGAGTGAGAAGGAGG - Intronic
1087137823 11:94738588-94738610 GGGTGTAGATGGAAAGAAGGTGG + Intronic
1087138898 11:94746561-94746583 CAGGGGAGAAAGGGAGAAGGGGG - Intronic
1087177605 11:95109756-95109778 CAGTGGTGATGGGGAGGAGAAGG - Intronic
1087219963 11:95536036-95536058 TAGTGGAGAGGGTGAAAAGGGGG + Intergenic
1087653261 11:100892939-100892961 CACTGGAGATGGAGAACAGGTGG + Intronic
1088245843 11:107817336-107817358 CATTAGAGATGGAGATAAGAGGG + Intronic
1088490262 11:110379935-110379957 AAAAGGAGATGGAGAGTAGGGGG + Intergenic
1088549481 11:110996904-110996926 CAGTGGAGTTCCAGAGAGGGAGG + Intergenic
1088831449 11:113540234-113540256 CAGAGGAGAAGCAGAGAAGCAGG + Intergenic
1088919659 11:114251737-114251759 CAGTGGAGAGGAGGAGGAGGAGG + Intergenic
1089196433 11:116696351-116696373 CAGTGGAGAGGGCGGGGAGGTGG - Intergenic
1089197830 11:116705327-116705349 CACTTGAGCTGGAGAGATGGAGG - Intergenic
1089566939 11:119376575-119376597 CAGTGAAGATGGCCAGGAGGAGG - Intronic
1090273351 11:125403109-125403131 GAGAGGAGATGGGGTGAAGGGGG + Intronic
1090572398 11:128061546-128061568 CACTGGAGGTGGGGAGAAAGAGG + Intergenic
1090735320 11:129607956-129607978 GAGAGGAGATTGAGAAAAGGTGG - Intergenic
1090799896 11:130163844-130163866 CAGTGGAAATGGTCAGAGGGTGG + Intronic
1091041409 11:132284763-132284785 CAGTGGCCTTGGGGAGAAGGCGG + Intronic
1091041937 11:132289479-132289501 CATGGGAGCTGGAGAGCAGGGGG - Intronic
1091096119 11:132823761-132823783 CAGTGGAGAGGCAGAGATGAAGG - Intronic
1091096198 11:132824592-132824614 CAGTGGAGAAGCAGAGATGAAGG - Intronic
1091121312 11:133060219-133060241 CTGAGGGGATGGGGAGAAGGAGG - Intronic
1091297783 11:134486079-134486101 GAGTGGAGAAGGGGAGAAAGGGG + Intergenic
1091303527 11:134523105-134523127 GAGTGGGGATGGAAGGAAGGTGG + Intergenic
1091340352 11:134807405-134807427 CACTGGAGATAGAGAGGAGGAGG + Intergenic
1091402511 12:189440-189462 CAGTCCAGAGGGAGACAAGGGGG + Intergenic
1091626690 12:2126584-2126606 AAGTGGAGGTGGAGAGAAGACGG + Intronic
1091636828 12:2203490-2203512 CACGGGAGATGGCGAGAAGCTGG - Intronic
1092229871 12:6770369-6770391 CTGTGGAGAGGGAGAGAATGGGG - Intronic
1092518234 12:9238357-9238379 TAGTAGAGATGGAGAGAAGTGGG + Intergenic
1092798209 12:12135338-12135360 GAGTGGAGGGGGAGAGAAGTGGG + Intronic
1092894002 12:12995809-12995831 TAATGGAGATGGGGTGAAGGAGG - Intronic
1093713004 12:22349292-22349314 CAGTAGAGATGAAGAAAAGAGGG + Intronic
1094083738 12:26566041-26566063 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094083745 12:26566079-26566101 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094525780 12:31229718-31229740 CAGTGGGGCTGGAGAGGCGGTGG - Intergenic
1094545533 12:31401240-31401262 CAGCAGAGATGGAAAGAAGTAGG + Intronic
1094701139 12:32871977-32871999 GAGTGGGGAGAGAGAGAAGGAGG - Intronic
1095131929 12:38553127-38553149 GAGAGGAGATGAAGGGAAGGGGG - Intergenic
1095158303 12:38885867-38885889 CAGGAGAGAGAGAGAGAAGGGGG - Intronic
1095370859 12:41465731-41465753 CAGTGGAGATGAAGAGGAGCAGG + Intronic
1095540407 12:43303293-43303315 CAGGGGTGATGGACAGAATGAGG + Intergenic
1095966515 12:47870725-47870747 CAGTGGAGATGGAGCCCAGAGGG - Intronic
1096052298 12:48621270-48621292 GGGTGGAGATGGAGGGAATGGGG + Intergenic
1096083620 12:48850196-48850218 CGATGGAGATGGAAAGAAGTAGG + Intronic
1096250393 12:50028258-50028280 CAGGGGTGAGGGAGAGAAGCAGG + Intronic
1096427965 12:51520346-51520368 CAATGGTGATGGAGAGGAAGAGG + Intergenic
1096538837 12:52291810-52291832 CAGAGGAGAGGACGAGAAGGAGG + Intronic
1096717175 12:53498700-53498722 CAGAGGAGATGGAGAGAAAGAGG + Intronic
1096747894 12:53740127-53740149 CAGTGGAGGTGGAGGGAGAGCGG - Intergenic
1096816893 12:54207469-54207491 CAGTGGAGGTGGGGGGAAGCAGG + Intergenic
1096922595 12:55103577-55103599 CAGGAGAGAGAGAGAGAAGGCGG - Intergenic
1097021173 12:56021664-56021686 CTGAGGAGATGGAGAGGATGGGG + Intronic
1097623168 12:61966139-61966161 CAGTGAAGATGAGGAGAAGTTGG - Intronic
1097669237 12:62516280-62516302 TGGTGGAGATGGGGAGCAGGGGG + Intronic
1097788961 12:63793672-63793694 TAGTAGAAATGGAGAGAAGTGGG + Intronic
1097800826 12:63912060-63912082 CACTGGGGAAGAAGAGAAGGGGG + Intronic
1097966352 12:65585659-65585681 GAGTGGAGCTGGAGGAAAGGAGG - Intergenic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098605966 12:72389937-72389959 TAGTGGAGGTGGTAAGAAGGGGG + Intronic
1098630141 12:72713046-72713068 CAGGCGAGAGGGAAAGAAGGAGG + Intergenic
1098819279 12:75208430-75208452 CAGGGGAGGAGGAGAGAATGGGG - Intronic
1098908494 12:76185864-76185886 AAGTGGGGGTGAAGAGAAGGTGG - Intergenic
1098908862 12:76188950-76188972 CAGTGTAGCTGGAGAAAAGTAGG - Intergenic
1099080200 12:78169153-78169175 CAGTGGAGATGGAGATGGAGTGG + Intronic
1099458463 12:82893942-82893964 CAGAGGAGATGGAGAGAAAAAGG + Intronic
1099861131 12:88227442-88227464 CACTGGAGATCGAGAGAGAGAGG + Intergenic
1099902964 12:88735290-88735312 GAGAGAAGAGGGAGAGAAGGAGG - Intergenic
1100497283 12:95137810-95137832 CAGTGGAAATGGTGAAAAGTAGG - Intronic
1101006620 12:100406959-100406981 CAATGGAGATGGAGAGAGGGGGG + Intronic
1101444634 12:104728838-104728860 GTGTGGAGATGGACAGAAAGGGG + Intronic
1101728924 12:107410615-107410637 CAGTGGAGATGGGGAGGACTTGG + Intronic
1101730443 12:107422601-107422623 CAGTGGAGGTGATGAGAAGTTGG + Intronic
1102116917 12:110409831-110409853 CAGGCGAGAGGGAAAGAAGGAGG + Intergenic
1102306515 12:111808835-111808857 CAGTGCAGGTGGAGAAAAGAGGG + Intronic
1102398317 12:112606744-112606766 CAGGAGAGAGTGAGAGAAGGGGG + Intronic
1102736504 12:115165608-115165630 CAGGGGAGATAGAGAGAGGTTGG - Intergenic
1103049109 12:117763852-117763874 CAGCAAAGATGGAGAGAAGTCGG + Intronic
1103099298 12:118158597-118158619 TAATGGAGATGGAGAGGAGTGGG - Intronic
1103781581 12:123402319-123402341 GAATGGAGATGGAGAGGAGGTGG + Intronic
1103843824 12:123887510-123887532 CATCGCAGACGGAGAGAAGGGGG - Intronic
1103911749 12:124355829-124355851 CAGTGGAAATGGGGAGACAGGGG - Intronic
1103919619 12:124392698-124392720 CAGTGGACATGTAGTGGAGGAGG + Intronic
1103948663 12:124540506-124540528 GAGTGGAGATGGGGGGATGGGGG + Intronic
1103973531 12:124687510-124687532 CAGGAGAGATAGAGAGATGGGGG - Intergenic
1104402487 12:128487858-128487880 CAGTGCAGATCTAGAGAATGAGG - Intronic
1104420671 12:128631987-128632009 GAGTGGGGATGGGGGGAAGGGGG + Intronic
1104489443 12:129181325-129181347 AAGTAGAGATGGAGAGAAGGAGG - Intronic
1104577383 12:129980263-129980285 CAGTGAAGATGGAAAGAATTGGG + Intergenic
1104666828 12:130653555-130653577 CAGTGGAGTTGGTGAGAAGAGGG - Intronic
1104676752 12:130716324-130716346 AGGGGGAGAGGGAGAGAAGGAGG + Intergenic
1104805445 12:131586581-131586603 CAGTGGAGCTGGGGAGAAACGGG + Intergenic
1104984121 12:132587097-132587119 CAGTGCAGCTGGAGGGAGGGCGG + Intergenic
1104984147 12:132587208-132587230 CAGTGCAGCTGGAGGGAGGGTGG + Intergenic
1104984183 12:132587364-132587386 CAGTGCAGCTGGAGGGAGGGTGG + Intergenic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1105580481 13:21691368-21691390 CAGAGGAGATGGAGAAAAACAGG + Intronic
1105968399 13:25405192-25405214 CAGTGCAGAAGGAGAAGAGGAGG + Intronic
1106587740 13:31072012-31072034 CAGCGGTGCTGGAGAGAAGAGGG - Intergenic
1106956153 13:34941968-34941990 AAGAGGATATTGAGAGAAGGAGG + Intergenic
1107346824 13:39470894-39470916 AAGTGGAGAGAGGGAGAAGGAGG - Intronic
1107755234 13:43614606-43614628 CAGTGAGCAGGGAGAGAAGGAGG - Intronic
1108139296 13:47401952-47401974 CAGTTGAAATGGAGAAAATGAGG - Intergenic
1108552782 13:51563245-51563267 CAGAGGTTGTGGAGAGAAGGGGG + Intergenic
1108723138 13:53152229-53152251 GAGTGGGGATGGAAAGGAGGGGG + Intergenic
1108929449 13:55798297-55798319 GGGTGGAGAAGGAGAGAATGGGG - Intergenic
1108941531 13:55962033-55962055 TATTAGAGAGGGAGAGAAGGAGG + Intergenic
1109144967 13:58768219-58768241 CAGTGGCTAGGGGGAGAAGGAGG - Intergenic
1109308448 13:60664481-60664503 CATGGGGGATGGAGAGAGGGAGG + Intergenic
1109826569 13:67729063-67729085 CAGTGCAGATTCAGAGAAGAAGG - Intergenic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110369252 13:74721099-74721121 CAGCGGGGAGGGGGAGAAGGAGG + Intergenic
1110505482 13:76280940-76280962 CTGTGGAAATGAAGAGAAAGAGG - Intergenic
1110639014 13:77799987-77800009 CAGAGGAGAAGCATAGAAGGAGG - Intergenic
1110832183 13:80044260-80044282 CAGGGGAGAGAGAGTGAAGGGGG - Intergenic
1111128922 13:83949107-83949129 CAGTGTAGATGCAGAGACAGAGG + Intergenic
1111489761 13:88956514-88956536 CATTGGAAATGGAAAGAAGATGG + Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1111956190 13:94761215-94761237 CAAAGGAGATGGGGAGAAAGGGG - Intergenic
1113134870 13:107078188-107078210 CAGGAGAGAGAGAGAGAAGGAGG - Intergenic
1113406563 13:110046316-110046338 CTGTGGAGAGGGGGAGTAGGAGG + Intergenic
1113425144 13:110201377-110201399 AAGAGGAGGAGGAGAGAAGGAGG + Intronic
1113599300 13:111557437-111557459 GAGTGGTGATGGAGAGAAAATGG + Intergenic
1114037067 14:18639254-18639276 CAGTGGAGATCCATTGAAGGAGG + Intergenic
1114121573 14:19675790-19675812 CAGTGGAGATCCATTGAAGGAGG - Intergenic
1114429202 14:22645902-22645924 CAGTGGGGCTGGAGAGGGGGTGG - Intergenic
1114476606 14:22999449-22999471 CAGTAAAGATGGTGAGGAGGAGG - Intronic
1114637501 14:24195978-24196000 CCGGGGAGATGGAGCGCAGGCGG + Intronic
1114947975 14:27711056-27711078 CAGTAGAGATGGAAAGAAGAGGG - Intergenic
1115143515 14:30200417-30200439 CAGAGATGATGAAGAGAAGGAGG - Intergenic
1115292398 14:31786996-31787018 CAGTGGAGAAAGAGAGAAGTGGG + Intronic
1115774652 14:36702153-36702175 CAGTAGAGAAGGAGAAATGGAGG - Intronic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1116427336 14:44807029-44807051 GAGGGAAGAAGGAGAGAAGGAGG + Intergenic
1117160482 14:52984590-52984612 CAGTGGAGATTGGGTGAATGAGG + Intergenic
1117201685 14:53396228-53396250 CAGAGGAGAGGGAGAGAAATGGG - Intergenic
1117473206 14:56067552-56067574 AAGTGGGGATGGAGAGAACTGGG + Intergenic
1117578981 14:57132199-57132221 AAGTGGAGCTGGAGTGAGGGAGG - Intergenic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1117762355 14:59042999-59043021 CAGTGGAGATGCAGAGCAACTGG - Intergenic
1118057741 14:62099318-62099340 CACTGGGGATGGAAAGAAGTGGG + Intronic
1118151976 14:63199520-63199542 CAGTAGCCATGGACAGAAGGTGG - Intergenic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1119182128 14:72612346-72612368 CAGAGGAGGTGGGGAGCAGGTGG - Intergenic
1119408666 14:74414369-74414391 AATGGGAGAGGGAGAGAAGGTGG + Intronic
1119457774 14:74770946-74770968 TAGTTGAGATGGAGAGAAGTGGG + Intronic
1119517592 14:75260401-75260423 CAGAGGAGATAGAGGAAAGGAGG - Intronic
1119562595 14:75603056-75603078 ATGTGGAGATGGAGGGGAGGTGG - Intronic
1119726379 14:76924210-76924232 CGGTGGGGAGGGGGAGAAGGGGG + Intergenic
1120138676 14:80901763-80901785 AGGTGGAGCTGGAGAGAAGGAGG - Intronic
1120545769 14:85809406-85809428 AAGTGGAGATGTAGAGAGGTAGG + Intergenic
1120547166 14:85826387-85826409 CAGTTGAAATAGAGACAAGGAGG + Intergenic
1121237799 14:92405662-92405684 CAGGAGAGAGAGAGAGAAGGGGG + Intronic
1121328984 14:93037734-93037756 CAGTGGAGATGGTGAGACTCAGG + Intronic
1121522845 14:94598258-94598280 CTGTGGAGATGGAGAGTGGGTGG + Intronic
1121971296 14:98358845-98358867 CAGTAGAAATGGAGAAAGGGTGG - Intergenic
1122240188 14:100359494-100359516 CAGTGGGGAGGGAGAAATGGGGG + Intronic
1122443695 14:101753628-101753650 CAGGAGAGAGAGAGAGAAGGGGG - Intergenic
1124241133 15:28028484-28028506 CAGTGGAGCTGTAGGGAAGGTGG + Intronic
1124292153 15:28463139-28463161 CAGTGGAAAAGGAGAGAACTTGG + Intergenic
1125329142 15:38565015-38565037 CAGGGGAGTTGGAGAGGAGCGGG + Intronic
1125408765 15:39382983-39383005 GAGTGGGGAAGGGGAGAAGGGGG + Intergenic
1125413640 15:39430274-39430296 CAGAGGAAATGGAGAAAATGGGG + Intergenic
1125466696 15:39960358-39960380 CAGGGGAGATAGAGAGGAGAAGG + Intronic
1125551102 15:40545505-40545527 CAGAGGAGGTGGAGAGAATGGGG + Intronic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1126410456 15:48368132-48368154 CAGAGCAGATGTAGAGAAAGGGG - Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126530266 15:49703289-49703311 CAGGTGAGAGGGAAAGAAGGAGG + Intergenic
1126859491 15:52870293-52870315 GTATGGTGATGGAGAGAAGGGGG + Intergenic
1127215611 15:56820356-56820378 GAGTGGAGATGTAGAGATGGTGG - Intronic
1127492703 15:59480047-59480069 TGGTGGAGATGGGGAGAAGATGG + Intronic
1127785544 15:62351737-62351759 CATTGGAGCAGCAGAGAAGGGGG + Intergenic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128270805 15:66307790-66307812 AGATGGAGATGGAGGGAAGGTGG + Intronic
1128757102 15:70190508-70190530 CTGTGGAGATGGCGGGACGGGGG + Intergenic
1128806914 15:70538078-70538100 AAGTGGACAAGGAGAGAAAGGGG - Intergenic
1128843888 15:70872405-70872427 TAGGGGAGAGGGAGAGGAGGAGG + Intronic
1129275586 15:74443187-74443209 CAGTGGGGAAGGAGAGGAGGAGG - Intergenic
1129521737 15:76190542-76190564 CAGTGGAGGTGGAGGGAGGCGGG + Intronic
1129646231 15:77436338-77436360 CAGTGGAGATGTAGCAAAGAGGG - Intronic
1129684642 15:77678035-77678057 CATTGGAGACTGTGAGAAGGAGG - Intronic
1129935856 15:79449803-79449825 TGGTAGGGATGGAGAGAAGGAGG - Intronic
1129954737 15:79625512-79625534 CAGAGGAGATGGTGAGGATGGGG + Intergenic
1130095099 15:80849982-80850004 CAGTGGTGGTGGGGAGAGGGCGG + Intronic
1130251214 15:82301384-82301406 TAGGTGAGATGGAGAGAGGGAGG - Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130826137 15:87548111-87548133 CTGAGGAGATGGGGAGAAGATGG + Intergenic
1130924669 15:88375941-88375963 AAGGAGGGATGGAGAGAAGGAGG - Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1130990763 15:88874354-88874376 CAGTGGACCTGGAAAGAAAGTGG - Intronic
1131413619 15:92232342-92232364 CTGTGGAAAAGGACAGAAGGAGG + Intergenic
1131515862 15:93076257-93076279 GAGTGGAAAGGGAGAGAAGGTGG - Intronic
1131545828 15:93314754-93314776 AGGTGGAGATGGTGAGAAGGTGG + Intergenic
1131709135 15:95033821-95033843 CAGTAGAGAGGAAGAGGAGGAGG - Intergenic
1132075743 15:98818416-98818438 GGGTGGAGAAGGGGAGAAGGAGG + Intronic
1132202226 15:99962888-99962910 CAGTGAAGATAGGGAGAAGTGGG + Intergenic
1132233444 15:100201334-100201356 CAGTGCAGCAGGAGAGAGGGGGG - Intronic
1132299524 15:100767432-100767454 GAGGGGAGATGGAGAGAGGGAGG - Intergenic
1132302766 15:100786805-100786827 ATGTGGATATGGAGAGAGGGCGG + Intergenic
1132435720 15:101800210-101800232 GAGTGGGGATGGAGAGAACAGGG + Intergenic
1132444687 15:101903368-101903390 TAGTGGAAATAGAGATAAGGAGG - Intergenic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1133395829 16:5446751-5446773 CGGTGGGGATGGACAGGAGGAGG - Intergenic
1133842733 16:9424908-9424930 GAGAAGAGAGGGAGAGAAGGTGG + Intergenic
1134201765 16:12205094-12205116 CAGTGAAGATGGAGAGTCGTGGG + Intronic
1134235076 16:12459134-12459156 AAGTGGAGAGGGGGAGGAGGGGG - Intronic
1134323124 16:13181757-13181779 TGATGGAGATGGGGAGAAGGGGG + Intronic
1135030604 16:19035274-19035296 GAGTGGAGAGGGAGAGAGGGAGG + Intronic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1135244426 16:20842976-20842998 CAGTGAAGATGTAGATAAGTTGG - Intronic
1135511454 16:23088101-23088123 CAGTGAAGATGGAGAGCACAGGG + Intronic
1135556028 16:23437319-23437341 GAGTGGGGATGGAGAGGTGGTGG - Intronic
1135609019 16:23848595-23848617 CAGTGGAGAGGGAGAGGGAGTGG - Intronic
1135698601 16:24611679-24611701 CAGTGGAGATGGACAGGGAGAGG + Intergenic
1135845070 16:25911426-25911448 AATGGGAGATGGAGACAAGGAGG - Intronic
1135985254 16:27179248-27179270 CTGTGGAGATGGGAAGATGGAGG + Intergenic
1136160249 16:28415170-28415192 CAGTGGAGAGGGCGGGGAGGGGG - Intergenic
1136173457 16:28502285-28502307 CAGTGGAGATGGAAGGAATGGGG - Intronic
1136202839 16:28700120-28700142 CAGTGGAGAGGGCGGGGAGGGGG + Intronic
1136237992 16:28926038-28926060 CGCTGGAGATGGAGAAAAAGGGG - Intronic
1136265083 16:29111500-29111522 GAGTGGGGCTGGACAGAAGGTGG + Intergenic
1136398051 16:30003803-30003825 CAGTGGGGAAGGAGAGGAGGTGG + Intronic
1136452347 16:30360448-30360470 CTGTGGAGGTGGAGAGGAGCAGG - Intronic
1136554836 16:31001573-31001595 CAGTGATGATGAAGAGGAGGTGG - Exonic
1136923016 16:34346786-34346808 CACTGGTGATGGTGAGAGGGAGG + Intergenic
1136981557 16:35065020-35065042 CACTGGTGATGGTGAGAGGGAGG - Intergenic
1137375912 16:47951732-47951754 CCATGGTGGTGGAGAGAAGGAGG - Intergenic
1137658444 16:50181812-50181834 CAGAGGTGATGGAGATGAGGTGG + Intronic
1137801030 16:51262171-51262193 CGGGGGAGAAGGAGGGAAGGAGG - Intergenic
1137847720 16:51708470-51708492 TAGTGGAGCTGGAGAAAAGATGG + Intergenic
1138069010 16:53971967-53971989 GAGTGGTGAAGGAGGGAAGGGGG - Intronic
1138562105 16:57807416-57807438 CAGTGGGCATGGAGAGGTGGTGG + Intronic
1138956439 16:61976385-61976407 CAGTCGAGAAAGAGAGAGGGAGG - Intronic
1139278546 16:65750120-65750142 GAGAAGAGAGGGAGAGAAGGAGG + Intergenic
1139738138 16:69010758-69010780 CACTGGAGATTGAGAGATGATGG - Intronic
1139823725 16:69740719-69740741 CAGTGGAGATGGTAGGAAGGAGG - Intergenic
1140191708 16:72823091-72823113 GAGTGGGGAGTGAGAGAAGGGGG + Intronic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1140413021 16:74752846-74752868 AGGTGAAGATGGAGTGAAGGCGG + Intronic
1140930040 16:79618948-79618970 CAGAGGAGACAGAGAGGAGGCGG - Intergenic
1141461530 16:84181050-84181072 CAGACGAGATGAAGAGTAGGGGG + Exonic
1141816163 16:86410594-86410616 GAGTGGAGATGGTGAGTAGGTGG + Intergenic
1141859937 16:86709670-86709692 CAGTGAAGCTGGAGAGAAGCAGG + Intergenic
1141906045 16:87027808-87027830 GAGTGGAGAGAGAGAGAAAGAGG - Intergenic
1142008010 16:87699385-87699407 CAGTGGTGATGTAGAAAAGCAGG + Intronic
1142014883 16:87740119-87740141 CAGGGGACAGGAAGAGAAGGTGG + Intronic
1142188304 16:88705349-88705371 CAGGGGAGAGAGAGAGCAGGAGG - Intronic
1142591710 17:1009170-1009192 CAGTGGGGATGGACAGCAGTGGG - Intronic
1143058404 17:4179819-4179841 CAATGGAGAAGGAGAGGAAGAGG - Exonic
1143074747 17:4331773-4331795 CAGAGGAGCTGCAGCGAAGGAGG + Intronic
1143168455 17:4911353-4911375 AGGGGGAGATGGAGAGAAAGAGG + Intergenic
1143296638 17:5876269-5876291 CACTGGGGATGGGGAGGAGGGGG + Intronic
1143311128 17:5990207-5990229 AAGTAGAGATGGAAAGAGGGAGG - Intronic
1143352167 17:6296999-6297021 TAGTAGAGATGGGGAGGAGGTGG - Intergenic
1143399893 17:6637303-6637325 CTGTGGAGAAGGAGACACGGTGG - Intronic
1143465348 17:7132765-7132787 CAGTGGAGACGGAGGGACAGTGG - Intergenic
1143622073 17:8086448-8086470 AGCTGGGGATGGAGAGAAGGAGG - Intronic
1144213819 17:13037157-13037179 CACTGGAGATGAAGAGCAGATGG + Intergenic
1144462328 17:15468181-15468203 CAATGGAGTTGGGGAGAAGGAGG - Intronic
1144620889 17:16817933-16817955 GAGTGGGGATGGGGAGAAAGTGG - Intergenic
1145055885 17:19703839-19703861 GAGTGGGGATGGGGAGAAAGTGG + Intronic
1145838088 17:27969993-27970015 CAGTGAAGCTGGAGAAAAGAGGG - Intergenic
1145916721 17:28578335-28578357 CAGAGGAGCTGGACAGCAGGTGG - Intronic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1146257169 17:31398411-31398433 CACTGGAGTTCTAGAGAAGGAGG + Intronic
1146477055 17:33171524-33171546 CAATGGTGATGGAGAAAAGCAGG - Intronic
1146499750 17:33354304-33354326 TAGTGGGGATGGAGAGCATGAGG - Intronic
1146530546 17:33604341-33604363 GAGTGGACATGGAGAGCAGGTGG + Intronic
1146562729 17:33885056-33885078 CAGTGGAGCTGGTAAGTAGGGGG - Intronic
1146624272 17:34424066-34424088 GAGTGGAGACGGAGGGATGGAGG + Intergenic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1146833641 17:36091976-36091998 CAGTGGAGCTGCAGAGCAGTGGG + Intergenic
1146848231 17:36198815-36198837 CAGTGGAGCTGCAGAGCAGTGGG + Intronic
1147062013 17:37887596-37887618 TAGTGGAGATGGAGAGAGATAGG - Intergenic
1147166472 17:38596189-38596211 CAGAGGAGCTGGAGAGAGGAGGG + Intronic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147527209 17:41237440-41237462 CAGAGCAGATCGAGAGCAGGGGG - Intronic
1147528333 17:41249110-41249132 CAGAGCAGATCGAGAGCAGGTGG - Intronic
1147685980 17:42287265-42287287 GAGTGGAAATGGAGAGAAAAGGG + Intergenic
1147918183 17:43900830-43900852 CGGTGGGGATGGGGAGGAGGCGG + Intronic
1148088257 17:45007293-45007315 AAATGGAGATGGACAGTAGGAGG - Intergenic
1148535708 17:48436941-48436963 CAGTTAAGATGGACAGAAAGAGG - Intergenic
1148554004 17:48566993-48567015 CACTGGAGATTGTGAGGAGGTGG - Intronic
1148675323 17:49441580-49441602 CAATGGAGAGGCAGAGAAGATGG + Intronic
1148712090 17:49689365-49689387 CAGTGGAGATGGAAGGAAGTAGG - Intergenic
1149003987 17:51785526-51785548 CAGTGAAGATGTAGAGAAAAGGG + Intronic
1149317321 17:55450836-55450858 CAAAGGAGATGGAAAGAAGTGGG - Intergenic
1149610718 17:57955953-57955975 CACAGGAGATGGTGGGAAGGGGG + Intergenic
1150383746 17:64741145-64741167 CAGTGGAGAGGAAGGGAAGCTGG - Intergenic
1150506822 17:65707315-65707337 TACTAGAGATGGAGAGAAGTGGG - Intronic
1150628610 17:66859846-66859868 GGGTGGAGAGGGAGAGAAGAGGG - Intronic
1150772652 17:68054725-68054747 CAGTGGAGAGGAAGGGAAGCTGG + Intergenic
1150901420 17:69282289-69282311 CAGTGGAGAAGGAGCCAAGAGGG - Intronic
1150935928 17:69635694-69635716 CTGTGGAGATGGACAGAAAAGGG + Intergenic
1151407998 17:73902036-73902058 CAGTGGAGATGGGGGGCGGGGGG - Intergenic
1151546577 17:74796955-74796977 CAGGGTAGATGGGCAGAAGGAGG + Intronic
1151712967 17:75817311-75817333 CAGAGGAGCTGCGGAGAAGGAGG - Exonic
1152154794 17:78625927-78625949 CAGTGGCCATGCAGAGAAGCAGG + Intergenic
1152295324 17:79463928-79463950 CAGTGGCGATGGTGGGGAGGTGG - Intronic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1152703652 17:81832322-81832344 CAGGGGAGAGGGTGAGGAGGTGG - Intronic
1152885209 17:82845438-82845460 CAGACGAGATGGAGAGGAAGGGG - Intronic
1153092707 18:1366593-1366615 AAGTGTGGAGGGAGAGAAGGAGG - Intergenic
1153098343 18:1435428-1435450 CAGTGAAGTTGGAAAGAAGTAGG - Intergenic
1153590451 18:6669090-6669112 GAGAGGAGAGGGAGGGAAGGAGG + Intergenic
1153679032 18:7483073-7483095 CAGTGGAGACGGAGCTTAGGAGG - Intergenic
1153759186 18:8313737-8313759 CAGGGGAAAGGGGGAGAAGGGGG - Intronic
1153770931 18:8416039-8416061 GGGAGGAGATGGAGAGAGGGTGG - Intergenic
1154026864 18:10716188-10716210 CAGAGGTGGAGGAGAGAAGGTGG - Intronic
1154247550 18:12713122-12713144 CAGTGGAGGAGGAAAGAAGTCGG - Intronic
1154339703 18:13492771-13492793 CTGTGGGGATGGAGAAAATGAGG - Intronic
1155080977 18:22409338-22409360 CAGCAAAGATGGAGAGAAAGTGG - Intergenic
1155325305 18:24658504-24658526 TGGGGGAGATGGAGAGGAGGAGG + Intergenic
1155351117 18:24907241-24907263 CAGTACAGGTGGAGAGAAGTAGG - Intergenic
1155530326 18:26760091-26760113 CCTTGGAGTTGGAGAGAAGGGGG + Intergenic
1155576040 18:27248047-27248069 CAGTGGAAGTGGGGAGAAGTGGG - Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155582329 18:27323844-27323866 CTGGGGAGATGCAGAGAAGCTGG - Intergenic
1155627100 18:27846905-27846927 CAGTGGTGATGGACAGAAGTGGG - Intergenic
1155662045 18:28260811-28260833 GGGTGGAGATGAAGAGAAGTTGG + Intergenic
1156483451 18:37450404-37450426 CAGGGGAGAGGGAGGGAGGGAGG - Intronic
1156601234 18:38609714-38609736 CAGTGGAAAAGGACAGAATGAGG + Intergenic
1156920985 18:42522116-42522138 CAGTGGAGATGAAGAGTAATAGG - Intergenic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1157279339 18:46335369-46335391 GAGTGGAGGTGGGGAGAAGAGGG - Intronic
1157385932 18:47260200-47260222 CAGTGGAGAAGGGAAGAGGGAGG - Intergenic
1157470161 18:47982614-47982636 AAGGGGAGAAGGGGAGAAGGGGG + Intergenic
1157477559 18:48033155-48033177 CAGGGCAGATGGAGAGAATCTGG + Intronic
1157492445 18:48133808-48133830 CTGTGGAGATGAATAGAGGGAGG - Intronic
1157514682 18:48302371-48302393 CAGTAAAAAGGGAGAGAAGGTGG - Intronic
1157540912 18:48505822-48505844 CAGTGGAGGTGGTGGGAGGGTGG - Intergenic
1157572667 18:48723407-48723429 TAGTGCAGGTGGGGAGAAGGTGG - Intronic
1158387846 18:57014948-57014970 CAGTAGAGATGGAGAACAGCTGG - Intronic
1158410779 18:57203966-57203988 CAGTGGAAAGAGAGATAAGGGGG + Intergenic
1158524078 18:58196927-58196949 AAGAGGAGATGGTGAGGAGGAGG + Intronic
1159108176 18:64027124-64027146 TAGTGGAGATGGAGGGGCGGGGG + Intergenic
1159225171 18:65523835-65523857 CTGTGGAAATGGAGTGATGGTGG + Intergenic
1159241105 18:65744971-65744993 CAGTGGGCATGGAGTGGAGGGGG + Intergenic
1159374002 18:67567226-67567248 CAGTGGTGATGGATAGGAAGAGG - Intergenic
1159404190 18:67977956-67977978 CACTGGAAATGGACAGAGGGAGG - Intergenic
1159626383 18:70700149-70700171 AAGGGGAGATGGAGAGAAGCTGG - Intergenic
1159920244 18:74221265-74221287 CAGGTGAGAAGGAGAGAAGGAGG + Intergenic
1160000802 18:75019825-75019847 CAGGAGAGAGAGAGAGAAGGGGG + Intronic
1160133006 18:76246414-76246436 CATTGGAGATGGACAGGAGAAGG - Intergenic
1160640667 19:131435-131457 TAGTGGAAATAGAGATAAGGAGG + Intergenic
1160809493 19:1007300-1007322 CAGGGGAGAGGCAGAGGAGGTGG + Intronic
1161256130 19:3310791-3310813 AAGGAGAGATGGAGAGAGGGAGG - Intergenic
1161465964 19:4430637-4430659 CAGAGGTGAGGGAGTGAAGGGGG + Exonic
1161501526 19:4618641-4618663 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501531 19:4618675-4618697 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501534 19:4618692-4618714 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501541 19:4618743-4618765 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501546 19:4618777-4618799 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501549 19:4618794-4618816 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501556 19:4618845-4618867 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501567 19:4618913-4618935 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501572 19:4618947-4618969 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501583 19:4619032-4619054 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501588 19:4619066-4619088 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501592 19:4619100-4619122 CAGAGGAGAGGGAGAGACTGAGG - Intergenic
1161501595 19:4619117-4619139 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501601 19:4619166-4619188 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501608 19:4619217-4619239 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501611 19:4619234-4619256 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501617 19:4619285-4619307 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501624 19:4619336-4619358 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501627 19:4619353-4619375 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501633 19:4619404-4619426 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501640 19:4619455-4619477 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161501653 19:4619557-4619579 CAGAGGAGAGGGAGAGATAGAGG - Intergenic
1161501656 19:4619574-4619596 CAGAGGAGAGGGAGAGACAGAGG - Intergenic
1161783593 19:6309800-6309822 CAGTGGTGATGAAGACCAGGCGG + Exonic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162054116 19:8052663-8052685 GAGTGCAGGTGGAGAGGAGGAGG + Intronic
1162668035 19:12231576-12231598 CAGTGGAAATGGGGAAATGGAGG + Intronic
1162756424 19:12863286-12863308 CAGAGGAGGAGGAGAGAAGGGGG + Intronic
1163061246 19:14763830-14763852 GAGAGGAGGAGGAGAGAAGGAGG - Intronic
1163115170 19:15184862-15184884 CAGAGGAGATGGAGAGGAGGAGG + Intronic
1163255953 19:16155968-16155990 TGGTGGAGATGGAAAGAAGGAGG + Intronic
1163570560 19:18079540-18079562 TACCGGGGATGGAGAGAAGGAGG - Intronic
1163662240 19:18585442-18585464 GAGTGGAGGCGAAGAGAAGGAGG - Intronic
1164324504 19:24179980-24180002 AGGTGGAGGAGGAGAGAAGGAGG + Intergenic
1164581304 19:29437041-29437063 GAGTGGGGCTGGAGAGATGGAGG + Intergenic
1164581626 19:29438695-29438717 GAGGGGAGAGGGAGAGAGGGAGG + Intergenic
1164649900 19:29884205-29884227 AAGGTGAGAGGGAGAGAAGGAGG - Intergenic
1164700309 19:30280116-30280138 AAGTGCAGATGGACAGATGGAGG - Intronic
1164741143 19:30576358-30576380 CAGTGGAGATGGAGGAACGATGG - Intronic
1164802692 19:31090752-31090774 AAGGGGAGACAGAGAGAAGGAGG + Intergenic
1164986384 19:32651784-32651806 CAGTGGGGATGCAGTGAATGGGG - Intronic
1165340181 19:35205683-35205705 AAATGGAGAGGGAGAGAAGGAGG - Intergenic
1166053291 19:40273931-40273953 CAGTGAGGCTGGAGAGCAGGCGG - Intronic
1166173363 19:41048054-41048076 CAGTGAAGCTGGGGAGGAGGTGG - Intergenic
1166305546 19:41935134-41935156 CAGGGGAGAGGGAGAGAGAGAGG + Intergenic
1166565650 19:43763864-43763886 CAGTGGAGAATGAGGGCAGGCGG + Intergenic
1166594598 19:44034361-44034383 CAAAGGAGATAGAGAGAAGGAGG + Intergenic
1166678715 19:44754683-44754705 CCTGGGAGATGCAGAGAAGGGGG + Intronic
1166879737 19:45920492-45920514 CAGGGGAGATGAAGACCAGGGGG + Intergenic
1166974828 19:46599952-46599974 CAGTGGAGAGGTAAAGAAGATGG - Intronic
1167030980 19:46960184-46960206 CAGGGCTAATGGAGAGAAGGCGG - Intronic
1167435191 19:49474980-49475002 CAGAGGAGAGGGAGATAAAGAGG + Intronic
1167435220 19:49475073-49475095 GAGGGAAGATGGAGAGGAGGGGG + Intronic
1167435231 19:49475109-49475131 GAGGGGAGATGGACAGGAGGGGG + Intronic
1167787840 19:51650363-51650385 CAGTGGAAGTGGTGAGAAGAGGG + Intergenic
1167821433 19:51932008-51932030 CAAAAGAGATAGAGAGAAGGGGG + Intronic
1168099486 19:54133743-54133765 GAGGGGAGGTGGAGAGAAGGAGG - Intergenic
1168099494 19:54133772-54133794 GAGGGGAGGTGGAGAGAGGGAGG - Intergenic
1168099511 19:54133832-54133854 GAGGGGAGGTGGAGAGAGGGAGG - Intergenic
1168099585 19:54134046-54134068 GAGGGGAGGTGGAGAGAGGGAGG - Intergenic
1168099609 19:54134110-54134132 GAGGGGAGGTGGAGAGAGGGAGG - Intergenic
1168099660 19:54134251-54134273 GAGGGGAGGTGGAGAGAGGGAGG - Intergenic
1168103585 19:54153680-54153702 CAGTGGAGAGGGGGATCAGGGGG - Intronic
1168138924 19:54371769-54371791 CAGTGGAAATGGAGAAACGCAGG - Intergenic
1168159010 19:54496094-54496116 CAGTGGAAATGGAGAAACGCAGG + Intergenic
1168167925 19:54565999-54566021 CAGTGGACAGGGAGAAAAGTAGG + Intergenic
1168259445 19:55185386-55185408 AGGTGAAGAGGGAGAGAAGGAGG - Intronic
1168470747 19:56638760-56638782 CAATGGGGATGGAGAGCAGTGGG - Intergenic
1168483755 19:56743168-56743190 CACTGGAACTCGAGAGAAGGAGG + Intergenic
1168633007 19:57971962-57971984 CAGTGGAGATGGGTAGGTGGTGG + Intronic
1168679024 19:58300378-58300400 CAGTGAAGACTGAAAGAAGGGGG + Exonic
925348365 2:3185553-3185575 CAGTGGAGAAGCACAGAGGGGGG - Intergenic
925384983 2:3455531-3455553 TCATGGAGATGGAGAGCAGGAGG - Intronic
925616468 2:5748683-5748705 CAGGGCAGATGGAGAAAGGGTGG - Intergenic
926109653 2:10173756-10173778 CAGTGAAATTGGAGAGAACGAGG + Intronic
926114982 2:10207265-10207287 CCATGGAGATGGAGAGAAAAGGG - Intronic
926400402 2:12490698-12490720 CAGAGGAGGAGGAGAGAAGTGGG - Intergenic
926560051 2:14406863-14406885 CAGTGGAGATGAAGAAGAGTAGG - Intergenic
926604640 2:14885251-14885273 GAGTAGAGATGGAGAGAAATGGG + Intergenic
926803582 2:16684072-16684094 AAGTGGAGATGAAGAGAAACTGG - Intergenic
926951816 2:18251603-18251625 CAGGGCAGCAGGAGAGAAGGGGG + Intronic
927099115 2:19774362-19774384 CAGTGTAGATGGAGATATGAGGG + Intergenic
927110890 2:19863129-19863151 CAGGTGAGAGGGAGAGAGGGGGG + Intergenic
927191056 2:20517243-20517265 CAGTGCAGAGCCAGAGAAGGAGG + Intergenic
928000622 2:27520243-27520265 CAGTGGAGGTATAAAGAAGGTGG + Intronic
928102965 2:28450111-28450133 CAGAGGAGGGGGAAAGAAGGAGG - Intergenic
928300775 2:30122071-30122093 ATCTGAAGATGGAGAGAAGGAGG + Intergenic
928399117 2:30965347-30965369 CAGAGGAGCTGGAGTGAGGGCGG + Intronic
928400345 2:30973264-30973286 CACTGGTGATGGAGTGATGGAGG - Intronic
928445339 2:31329088-31329110 CAGTGGGGATGGAGAATGGGGGG + Intergenic
928770070 2:34695409-34695431 CAGGCGAGAGGGAAAGAAGGAGG - Intergenic
928814007 2:35267545-35267567 CAGGGGAAAGGGAGAGAAGTTGG - Intergenic
928898955 2:36297382-36297404 GAGTAGAGTTGGAGAGAATGTGG - Intergenic
928922453 2:36539659-36539681 CCGTGGAGGTGGGGAGAAGTGGG + Intronic
929814865 2:45222648-45222670 CAGGGGAGAAGGAGGGATGGGGG + Intergenic
929867845 2:45733678-45733700 TAGTGGAGACGGTGAGAGGGAGG - Intronic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930209811 2:48623903-48623925 AAGGAGAGAAGGAGAGAAGGGGG + Intronic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
930985664 2:57584768-57584790 TAGTGGGGATGGCGAGGAGGTGG - Intergenic
931083021 2:58796895-58796917 CAGTGGAGAGGGAGAGGAAAAGG - Intergenic
931343531 2:61425736-61425758 CAGTAGAGGTGGTGGGAAGGGGG + Intronic
931690806 2:64833498-64833520 CAGTTGAGAAAGAGAGAGGGAGG + Intergenic
931807361 2:65820172-65820194 TAGTAGAGGTGGAGAGAAGCAGG - Intergenic
931810646 2:65851422-65851444 TAGTGAAGATGGAGAGAAGTGGG + Intergenic
932165082 2:69498501-69498523 CAGGGGAGGTGGGGAGAAAGAGG - Intronic
932207756 2:69898437-69898459 GAGAGGGGATGGAGAGAGGGAGG + Intronic
932253962 2:70267774-70267796 CCGTGGAGAGGGAGAGGGGGAGG + Intronic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932807709 2:74797041-74797063 CAGTGGAGAGGGAGAGGGAGAGG + Intergenic
932819934 2:74890966-74890988 CAGGGAAGAAGGAGAGAAAGAGG - Exonic
932883607 2:75527416-75527438 CAGTGGAGAGGGGGAGGGGGAGG - Intronic
933137778 2:78759067-78759089 GAGTGGAGACACAGAGAAGGGGG - Intergenic
933321153 2:80777267-80777289 CTGAGGAGGTGGAGAGAAGCTGG + Intergenic
933676613 2:85063204-85063226 CAGTGAAGATGGTGGGAAGGGGG - Intergenic
933813448 2:86047787-86047809 CTGGGGAGATGCTGAGAAGGGGG + Intronic
934015718 2:87879497-87879519 TAATGGAGATAGAGAGTAGGAGG - Intergenic
934708390 2:96500393-96500415 CAGGGGAGGTGGGGAGATGGGGG - Intronic
935177236 2:100660290-100660312 AAGCAGAAATGGAGAGAAGGAGG + Intergenic
935482139 2:103603482-103603504 CAGTGGGAATGGAGAGAGTGAGG + Intergenic
936019441 2:108983737-108983759 CTTTGGAGTTGGAGAGAAGGTGG - Intronic
936020118 2:108988429-108988451 GCGGGGAGAGGGAGAGAAGGAGG - Intronic
936719575 2:115234608-115234630 CAGTGTGCATGGTGAGAAGGTGG - Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936911902 2:117602240-117602262 TGGGGGAGATGGAGAGAAGCAGG - Intergenic
936993007 2:118386096-118386118 AAGTGGGGATGAAGAGAGGGAGG + Intergenic
937048841 2:118871609-118871631 CAGAGGAGCTGGAAAGAAGTAGG - Intergenic
937198292 2:120179896-120179918 CAGTGGAGGTGGAGGGAGTGTGG + Intergenic
937239711 2:120452219-120452241 CAGTGGGGATGGAGTGAAAGTGG - Intergenic
937334946 2:121056486-121056508 CAGTGGGGATGGAGAGAGGATGG + Intergenic
937421014 2:121755521-121755543 CAGAGGAGAGGGAGAGTGGGCGG - Exonic
937683918 2:124674473-124674495 AAGTAGAGAGGGAGAGAGGGAGG - Intronic
937954916 2:127416767-127416789 GGGTGGAGGTGGAGAGGAGGTGG - Intergenic
938031420 2:127997635-127997657 CAGTGGGGATGGTGAGCAGGGGG + Intronic
938220310 2:129560657-129560679 CAGGGGACAGAGAGAGAAGGAGG - Intergenic
938256388 2:129862898-129862920 CAGTGCAGAGAGAGAGAAGAGGG - Intergenic
938705153 2:133917333-133917355 AAGTGGAGATGAAGGGAATGGGG + Intergenic
939706428 2:145458920-145458942 CAGTGGAGCTGGTGAGAACAAGG + Intergenic
939786237 2:146516692-146516714 CAGTAGAGATGGAGATAAGCGGG + Intergenic
940277909 2:151958655-151958677 TAGTGGGGATGGAGAGGAGGAGG - Intronic
941786865 2:169506351-169506373 GAGTGGAGGTGGGGGGAAGGTGG + Exonic
942034011 2:171993121-171993143 GAGTGGAGGTGGAGAGTGGGAGG + Intronic
942534124 2:176945547-176945569 CTGAGGAGAGTGAGAGAAGGGGG - Intergenic
942840946 2:180360061-180360083 CACAGGAAATGGAGAGAAGCAGG + Intergenic
944307585 2:198195503-198195525 CAGGGGAGAGAGAGTGAAGGGGG + Intronic
944457179 2:199907849-199907871 CAGTTGAGAGGGAGAGGAGTGGG - Intergenic
944637596 2:201689825-201689847 CAAGTGAGATGGAGAGGAGGCGG + Intronic
945451016 2:209995343-209995365 CACTGAAGAAGGAGAAAAGGAGG + Exonic
945604936 2:211917359-211917381 CAGTGGAGATGGGTACAGGGTGG + Intronic
945643317 2:212458757-212458779 AAGTTAAGAAGGAGAGAAGGAGG + Intronic
945779135 2:214146220-214146242 ATGTGGAGATGGAGAGATGTGGG - Intronic
946043521 2:216802810-216802832 GAGTGGGGAAGGAGAGGAGGAGG + Intergenic
946419075 2:219554746-219554768 CGGGGGAGATGGAGAGAGGGAGG + Intronic
946449551 2:219768181-219768203 CAGTGGAGGTGGTGTGATGGTGG + Intergenic
946512219 2:220370379-220370401 CAGTGCAGGTGGTGAGAAGTGGG - Intergenic
946677093 2:222171707-222171729 CAGCTGAGGAGGAGAGAAGGAGG - Intergenic
946751639 2:222897907-222897929 CCGTGGAGAGGGAGAGGGGGAGG + Intronic
946919232 2:224560692-224560714 GAGTGGAGATGGAGACCAGTTGG - Intronic
947120979 2:226814571-226814593 CAAAGGAGATGGAGAGCATGAGG + Intergenic
947269699 2:228320220-228320242 CAAGTGAGAGGGAGAGAAGGAGG + Intergenic
947403052 2:229747978-229748000 CAGTTGAGGTGTAGAGAAGCTGG - Intergenic
948169565 2:235890092-235890114 CTGTGTAGGTTGAGAGAAGGAGG + Intronic
948238992 2:236412980-236413002 CCGTGGAGATGGGGAGATGTGGG + Intronic
948272831 2:236687439-236687461 CAGTGGGGATTAAGAGGAGGTGG + Intergenic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948558404 2:238834131-238834153 CAGGGAAGATGGATAGATGGCGG - Intergenic
948583225 2:239002457-239002479 GCGTGGACAGGGAGAGAAGGAGG - Intergenic
948584390 2:239009799-239009821 CAGAGGAGCTGGAGAGGAGACGG + Intergenic
948670633 2:239566472-239566494 CAGTGGAGATGAAGAGAGACAGG + Intergenic
948879133 2:240847259-240847281 CAGCGGAGAGGGAGAGAAGGAGG - Intergenic
949043286 2:241859074-241859096 CAGAGGAGATGGGGAGGAGGTGG + Intergenic
1169226149 20:3858232-3858254 CAGGGGAGGGGAAGAGAAGGAGG - Intronic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1169423449 20:5477766-5477788 CAGAGGGGATCAAGAGAAGGGGG + Intergenic
1169424727 20:5486916-5486938 CAGAGGGGATCAAGAGAAGGGGG + Intergenic
1169427552 20:5508510-5508532 CAGAGGGGATCAAGAGAAGGGGG - Intergenic
1169439568 20:5622818-5622840 CAATGTGCATGGAGAGAAGGTGG + Intergenic
1169525964 20:6426141-6426163 AAGAGGAGAGAGAGAGAAGGGGG - Intergenic
1169586325 20:7089901-7089923 AAGGGGAGAAGGGGAGAAGGGGG + Intergenic
1169688108 20:8299827-8299849 AAGTGAAAATGGAGAGAAGTGGG - Intronic
1169776461 20:9259582-9259604 TGGCAGAGATGGAGAGAAGGAGG + Intronic
1170008582 20:11695645-11695667 CAGTGGACAGGGAGAGGTGGTGG - Intergenic
1170630246 20:18058822-18058844 GAGGGGAGAGGGAGAGAAGGAGG + Intronic
1170687689 20:18584345-18584367 CAGGAGGGATGGAGAGAAGAGGG + Intronic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1171303898 20:24088480-24088502 CAGTGAAACTGGAGTGAAGGAGG - Intergenic
1172074292 20:32282210-32282232 CAGTGGAGATGGTAAGAGGACGG + Intronic
1172137591 20:32697661-32697683 CAGTGGAGATGGAGCACTGGAGG + Intergenic
1172578930 20:36031419-36031441 TAGAGGAGGTGGAGACAAGGAGG + Intergenic
1172624659 20:36340282-36340304 AAGTGGAGATGGTGAGGAAGGGG + Intronic
1172723457 20:37016924-37016946 CAGGGGAGGGGGAGAGGAGGGGG + Intronic
1172773499 20:37394729-37394751 CAGAGGGGCTGGAGAGAAAGGGG - Intronic
1172789598 20:37493702-37493724 CAGTGCAGATGGAGAGAAGGCGG - Intronic
1172790505 20:37502095-37502117 AGGTGGAGCTGGAGAGAAGGAGG - Intronic
1173230945 20:41197073-41197095 CAGGGCTGATGGAGAGAAGAAGG + Intronic
1173430381 20:42982612-42982634 CAGTGTAGATGGATCGAAAGGGG + Intronic
1173522569 20:43710674-43710696 CAGTGGAGAGAGACAGCAGGGGG - Intronic
1173667483 20:44773311-44773333 CAGTGGAGATAGAGGGTCGGGGG - Intronic
1174052865 20:47779418-47779440 CAATGGAGATGGAGTGAAATGGG - Intronic
1174332272 20:49829849-49829871 CATGGGAGATGGAAAGAAGGGGG + Intronic
1174747554 20:53078709-53078731 CAATAGAGATGTAGAGAAGTGGG + Intronic
1175110523 20:56644843-56644865 CAGGGGAAGTGGAGAGTAGGGGG + Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175314910 20:58040410-58040432 CAGAGGCGAGGGAGAGAGGGAGG - Intergenic
1175337288 20:58204942-58204964 CAGGGGAGATGGAGCCGAGGGGG - Intergenic
1175853262 20:62104927-62104949 CAGGGGAGGTGGAGAAAAGGAGG + Intergenic
1176199392 20:63853745-63853767 GAGTGGAGACGGGGAGCAGGAGG - Intergenic
1177203484 21:17984077-17984099 CTGTGGAGAGGGAGAAATGGGGG - Intronic
1177244249 21:18502219-18502241 CAGAGGAGATAGAGGGATGGAGG + Intergenic
1177497726 21:21910855-21910877 CAGAAGAGAGGCAGAGAAGGAGG - Intergenic
1177722930 21:24930180-24930202 AAGTGGAGATGGAGAGAAGGGGG - Intergenic
1177774347 21:25551272-25551294 CAGTAGAGATGGACAGATGTAGG + Intergenic
1178126886 21:29525906-29525928 CAGGAGAGAGGGAGTGAAGGGGG + Intronic
1178226493 21:30725322-30725344 AAGTGGGGAGGGAGAAAAGGAGG + Intergenic
1178235529 21:30836890-30836912 CAATAGAGCTGGGGAGAAGGGGG + Intergenic
1178596858 21:33962161-33962183 GAGTGGAGTTGGAGAGAAACAGG + Intergenic
1178797526 21:35758654-35758676 AAAGGGAGATGAAGAGAAGGTGG + Intronic
1178920587 21:36735823-36735845 CAGGGGAGAAGCTGAGAAGGTGG + Intronic
1179033049 21:37736661-37736683 ATGGGGAGATGGAGAGAGGGAGG + Intronic
1179338284 21:40479034-40479056 AAGTGGAGCTGCAGATAAGGGGG + Intronic
1179714618 21:43280611-43280633 CAGTGGAGGTGGAGGGGACGGGG + Intergenic
1179992810 21:44957453-44957475 TGGTGGAGATGAAGAGGAGGAGG - Intronic
1180148644 21:45936219-45936241 CAGTGGAGCAGGAGAAAAAGAGG + Intronic
1180461191 22:15566302-15566324 CAGTGGAGATCCATTGAAGGAGG + Intergenic
1180714188 22:17860336-17860358 AAATGGAAGTGGAGAGAAGGCGG + Intronic
1181922978 22:26334906-26334928 AAGGGGAGATGGAGAGATGCTGG - Intronic
1181933146 22:26418954-26418976 CACTGGAGCTGGAGAGCAAGAGG + Intergenic
1181985381 22:26796837-26796859 CAGTGGAGATGGGGAGGCTGAGG + Intergenic
1182079479 22:27518804-27518826 CACAAGAGATGGAGATAAGGAGG - Intergenic
1182243206 22:28933905-28933927 CGGTGGAGATGGAATGATGGTGG + Intronic
1182534262 22:30988496-30988518 CTTTGGAGTTGGAGAGAAGATGG + Intergenic
1182578840 22:31291634-31291656 AGGAGGAGATGGAGAGGAGGAGG + Intronic
1182624537 22:31636150-31636172 AAGGGGACAGGGAGAGAAGGAGG + Intronic
1182699235 22:32220587-32220609 AAGTAAAGTTGGAGAGAAGGTGG + Intronic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1182950023 22:34365075-34365097 AAGATGGGATGGAGAGAAGGAGG + Intergenic
1183025462 22:35062826-35062848 CAGGAGAGAGAGAGAGAAGGGGG + Intergenic
1183246541 22:36698128-36698150 AAGGAGAGAGGGAGAGAAGGGGG - Intronic
1183316343 22:37139052-37139074 CAGAGGAGGTGGAAGGAAGGAGG + Intronic
1183337628 22:37259663-37259685 AGGTGGAGAGCGAGAGAAGGAGG - Intergenic
1183381494 22:37492560-37492582 GAGTGGAGAGGGAGAGATGAAGG + Intronic
1183440315 22:37819179-37819201 GAGCGGAGGTGGAGGGAAGGAGG - Intergenic
1183698845 22:39438299-39438321 GAGGGGAGAGGGAGGGAAGGAGG - Intergenic
1183810139 22:40249156-40249178 CAGTGAAGATGGACACAAAGAGG - Intronic
1183832624 22:40426469-40426491 CAGTTGAGTAGGAGAGAAGGAGG - Intronic
1184772769 22:46607605-46607627 CAGCGGAGATGGAGCCAAGCAGG - Intronic
1184798609 22:46746747-46746769 CAGGGAAGGTGGAGAGAGGGAGG + Intergenic
1184968740 22:48000085-48000107 GAGTGGAGATGGGGAGAGGTTGG - Intergenic
1184989278 22:48156220-48156242 CAGTGGGTAGGGAGAGAGGGAGG - Intergenic
1185150525 22:49161306-49161328 AAGTGAAGAAGGACAGAAGGTGG - Intergenic
1185237755 22:49724777-49724799 CCGTGGAGAGGGAGAGACCGCGG - Intergenic
949935091 3:9110264-9110286 CTGTGGAGATGAAGAGGAGCAGG + Intronic
950011579 3:9727898-9727920 CAGTGGGGAGGGAGAGAAAGTGG + Intronic
950072313 3:10162650-10162672 CAGTGGTGATGGAGAGCCTGGGG + Intergenic
950210059 3:11116635-11116657 CAGAAGACAGGGAGAGAAGGAGG - Intergenic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
951164601 3:19469880-19469902 CAATGAAGATGGGAAGAAGGTGG - Intronic
951214917 3:20014740-20014762 CACTGGGGATGGAGACAAGTGGG - Intergenic
951632386 3:24736191-24736213 CAATGCTGCTGGAGAGAAGGAGG + Intergenic
951651302 3:24954652-24954674 CAATAGAGAGGGAGAGAAGGGGG + Intergenic
951927500 3:27924725-27924747 AATTGGAGATAGAGAAAAGGAGG - Intergenic
952070422 3:29627779-29627801 AAGAAGAGAGGGAGAGAAGGAGG + Intronic
952697168 3:36279457-36279479 CTTTGAAGATGGGGAGAAGGAGG + Intergenic
952901383 3:38114178-38114200 GAGTGGAGATGGCGGGAAGTGGG + Intronic
952907619 3:38152748-38152770 CAGTGGACATGGAGGGACTGGGG - Intergenic
953005963 3:38979680-38979702 CAGTGGAGATAGAGAGACTTTGG - Intergenic
953377921 3:42444472-42444494 CAGGAGAGAGAGAGAGAAGGGGG - Intergenic
953421965 3:42761224-42761246 CAGTGGGAATGGAGACATGGGGG - Intronic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
953924931 3:46978014-46978036 CAGTGGAGGTGGAGAGGGGGCGG - Intronic
953993010 3:47498384-47498406 CAGTGGAGATGCGGAGGATGAGG - Exonic
954217750 3:49133784-49133806 GCGTGGAGGGGGAGAGAAGGAGG + Intergenic
954258063 3:49419876-49419898 CAGTGGAGAGGAGGAGGAGGAGG + Intronic
954722761 3:52579775-52579797 CAGTGGGAATTGAGAGCAGGAGG - Intronic
954913600 3:54130277-54130299 CATTGGAGATGGAACAAAGGTGG - Intronic
955078067 3:55632459-55632481 CAGGTGAGATGGAGACAAGGAGG + Intronic
955521236 3:59777552-59777574 TAGTGGAGGTGGAGAGAAATAGG - Intronic
955524306 3:59804996-59805018 CAGGGGAGAGGGAGCTAAGGCGG + Intronic
955711067 3:61779537-61779559 CAGTGAAGATGGAGGGATGTAGG + Intronic
955741539 3:62096073-62096095 GAGTTGAGCTGGAGAGAAGTAGG + Intronic
956014499 3:64867385-64867407 TAGTGGAGAAGGAAAGAAGAGGG + Intergenic
956112597 3:65884737-65884759 AAGTGGGGATGGAGAGATGGAGG - Intronic
956136060 3:66100268-66100290 CTGTGGGGATGGAGAGCATGAGG - Intergenic
956301277 3:67775174-67775196 GAGGGGAGCTGGAGAGAGGGTGG + Intergenic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956471625 3:69573150-69573172 CAGTGAAGATAGAGAGAAGAGGG + Intergenic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
956851716 3:73234098-73234120 CAGTGGAGATGGAGAAATTGAGG - Intergenic
956878644 3:73488863-73488885 CAGCAGAGATGGGGAGGAGGGGG - Intronic
957021715 3:75135577-75135599 CAGTGGGCATGGAAAGAACGTGG - Intergenic
957769036 3:84663935-84663957 CAGGGGAGAAGGAGAGAGGAAGG + Intergenic
957813172 3:85254862-85254884 CACTGGAGAGAGACAGAAGGAGG - Intronic
957856032 3:85879995-85880017 CAGGGGCGATGGAGAGTAGAGGG - Intronic
958728299 3:97932838-97932860 CAGTGGATCTGGAAAGAAGATGG - Intronic
958743116 3:98098729-98098751 AAGGAGAGAGGGAGAGAAGGAGG - Intergenic
959629270 3:108490163-108490185 AGGTTGAGGTGGAGAGAAGGTGG + Intronic
959760307 3:109955262-109955284 GAGAGGAGATGGAGAGAAGTTGG - Intergenic
959783464 3:110264906-110264928 AAGTGGAGAGAGAGAGAGGGAGG - Intergenic
960141919 3:114159343-114159365 AGGGAGAGATGGAGAGAAGGTGG - Intronic
960231674 3:115235273-115235295 CAGTGGCCAAGGAGAGAAAGGGG + Intergenic
960268685 3:115650541-115650563 AAGTGGGAATGGGGAGAAGGAGG - Intronic
960421786 3:117455461-117455483 AAATGGAGATGAACAGAAGGGGG - Intergenic
960454778 3:117857284-117857306 AGTTGGAGATGGAGAGAAGTAGG - Intergenic
960488647 3:118283085-118283107 CAGAGGAGAAAGAGAGAAAGAGG - Intergenic
960537036 3:118826034-118826056 TGGTGGAAATGGAGAGAAGGAGG + Intergenic
960615281 3:119590852-119590874 CAGTGGTGAGGGGGAGGAGGGGG - Intergenic
960753590 3:120983242-120983264 CAGTGGAGATGCTCAGATGGGGG + Intronic
960807553 3:121598674-121598696 TGGTGGAGATGGAAAGAAGTGGG + Intronic
960875693 3:122293003-122293025 CAGAGGAGATGGAAAGACAGCGG + Intergenic
960970423 3:123135379-123135401 CAGGGGAGAGGAAGAGCAGGGGG - Intronic
961091564 3:124117202-124117224 CAGCTCAGAGGGAGAGAAGGGGG + Intronic
961208493 3:125107043-125107065 AAGAGGGGATGGACAGAAGGTGG - Intronic
961487026 3:127223692-127223714 GACTGGAGAGGGAGAGCAGGGGG + Intergenic
961500182 3:127326818-127326840 CAGTTGAGATGTATAGCAGGAGG - Intergenic
961658778 3:128457424-128457446 CAGTGCAGAGGGAGAGGAAGAGG + Intergenic
962022292 3:131513264-131513286 CAGGTGAGAGGGAAAGAAGGAGG + Intergenic
962132754 3:132699223-132699245 CAGTGAGGATGGGGAGAAGTGGG - Intronic
962384651 3:134923053-134923075 AAGTGGAGATGGGGGGAGGGAGG + Intronic
962472406 3:135723179-135723201 CAGTAGAGCTGGAGTGAAGATGG + Intergenic
962676906 3:137764421-137764443 AGGTGGAGAGGGGGAGAAGGAGG + Exonic
962710757 3:138083767-138083789 GAATGAAGATGGGGAGAAGGGGG + Intronic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963024434 3:140904759-140904781 CAGTGGAGATGGTGAGAACTGGG + Intergenic
963087610 3:141453121-141453143 CAGTGAAGATAGAGAGAAAGGGG + Intergenic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
963689911 3:148486761-148486783 GAGGGGAGAAGAAGAGAAGGAGG - Intergenic
963757888 3:149255220-149255242 CATTCCAGATGGAGAGAAGAGGG + Intergenic
964555789 3:157936565-157936587 CAGTGCATGTGGAGTGAAGGTGG - Intergenic
964669975 3:159214358-159214380 CAGTGAGGATCTAGAGAAGGTGG - Intronic
965347721 3:167572864-167572886 CAATGGCGAAGAAGAGAAGGAGG + Intronic
965464680 3:169013337-169013359 CAGTGCAGATAGAGAGAAGCAGG - Intergenic
965612787 3:170562485-170562507 CAGTGGGGAGGGTGGGAAGGGGG + Intronic
965915248 3:173837826-173837848 CAGTGCAGTTGGAGGGAAGTGGG + Intronic
966431051 3:179832134-179832156 CAGTGGAGAACGAGAGAATTAGG + Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966836522 3:184053608-184053630 AGATGGAGATAGAGAGAAGGAGG + Intronic
966881771 3:184354690-184354712 CAGTGGAGGGGGAGGGCAGGGGG + Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967313526 3:188129235-188129257 CAATGGAGCTGCAGAGATGGTGG + Intergenic
967514370 3:190349304-190349326 CAGGAGAGAAGGAGTGAAGGGGG - Intronic
967954665 3:194869076-194869098 CGCTGGAGATGGGGAGAAGAAGG + Intergenic
967983945 3:195081599-195081621 CAGTGTAGATGCAGAGAACCAGG - Intronic
968132377 3:196199037-196199059 CAGTGGAGACCAAGAGGAGGAGG - Intronic
968195379 3:196702174-196702196 CAGGGGAGATGGTGAGGATGGGG + Intronic
968505060 4:967694-967716 CAGTGGAGTTGGGGGGAATGAGG + Intronic
969157133 4:5220831-5220853 CAGTGGGGATGGAAAGTATGAGG + Intronic
969186668 4:5479515-5479537 CAGTGGAGGTGGAGTGGAGATGG + Intronic
969211356 4:5689939-5689961 CAGCAGAGCTGGAGAGAAGCTGG - Intronic
969333182 4:6491754-6491776 CAGGAGAGAGAGAGAGAAGGGGG - Intronic
970168985 4:13269975-13269997 CAGTGGGGGAGGAGAAAAGGAGG - Intergenic
970672244 4:18410323-18410345 CAGGAGAGATAGAGAGAACGAGG - Intergenic
970696739 4:18686623-18686645 AGGGGGAGAAGGAGAGAAGGAGG + Intergenic
970984016 4:22134478-22134500 CAGGAGAGAGAGAGAGAAGGAGG - Intergenic
970990678 4:22209677-22209699 CAGAAGAGAGGGAGTGAAGGGGG - Intergenic
971052424 4:22876260-22876282 CAGTGGAGATGAAGAGAGGTGGG - Intergenic
971429267 4:26547079-26547101 TGGTGGAGGTAGAGAGAAGGAGG - Intergenic
971729730 4:30361668-30361690 CATTGTAAATGGATAGAAGGAGG - Intergenic
971791330 4:31173622-31173644 GAGTGGAGAGTGAGAGGAGGGGG - Intergenic
972165632 4:36280790-36280812 CAGTGGGATTGGAGAGAGGGAGG + Intergenic
973336167 4:48958912-48958934 CAGTGGAAATGGAGAAGAAGAGG + Intergenic
973754997 4:54065451-54065473 CAGAGGAGAGGAAGAAAAGGAGG + Intronic
973865469 4:55108696-55108718 GAGTGGAGAGGGAGGGAGGGAGG - Intronic
974106888 4:57479935-57479957 CAGTGGAGAAGGTGGGAACGGGG - Intergenic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974178169 4:58351356-58351378 CAATAGAGATGGGGAGGAGGAGG + Intergenic
974761773 4:66285545-66285567 CAGTGCTGATGGAGGGCAGGAGG + Intergenic
975583559 4:75928610-75928632 GAGTGGAGATGCTGAGAAGATGG + Intronic
976540443 4:86268289-86268311 CAGTAAAGATGGTGAGAAGATGG - Intronic
976681193 4:87757961-87757983 AAGGGGAGAGGGAGAGAAAGGGG + Intergenic
977294080 4:95192408-95192430 CAGGGGAGGAGGTGAGAAGGGGG - Intronic
977782556 4:100995957-100995979 CAGGCGAGAGGGAAAGAAGGAGG + Intergenic
978277362 4:106967996-106968018 GAGAGGAGATGGAGAGATGAAGG + Intronic
978468830 4:109039087-109039109 CAGGGGAGATGTAGAGACTGGGG - Intronic
978645394 4:110925079-110925101 CAGCAGAGATGGAGAGAAACTGG - Intergenic
979108914 4:116725115-116725137 AAGTGGAGATGGCGAAAAGTAGG - Intergenic
979635948 4:122954318-122954340 TAGTGGAGCTGGGCAGAAGGTGG - Intronic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980419103 4:132536888-132536910 GAGAGGAGAAGGAGAGGAGGAGG - Intergenic
980680647 4:136155414-136155436 GAGGGGAGCTGGAGAGTAGGCGG + Intergenic
980807145 4:137828324-137828346 AAGTGGGGAAGGAGGGAAGGAGG + Intergenic
981412112 4:144443755-144443777 CAGGAGAGAAAGAGAGAAGGGGG + Intergenic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981735217 4:147942632-147942654 TAGGGGAGAAGGAAAGAAGGGGG - Intronic
981756657 4:148147210-148147232 CACTGGAGATGGAGGAAAGGTGG - Intronic
981917539 4:150051424-150051446 CAGTGGAGGTAGAGAGAAGTGGG - Intergenic
982018006 4:151174881-151174903 CAGTGGAGCTGAAGGGTAGGTGG + Exonic
982166576 4:152618709-152618731 AAGTGGAGGTGGAGAGAAAGTGG - Exonic
982190214 4:152846203-152846225 GAGTAGGGAGGGAGAGAAGGGGG + Intronic
982547244 4:156749277-156749299 CAGTGGGCATGGAGAGTGGGGGG + Intergenic
982550116 4:156787190-156787212 CAGTTGAGAGAGAGAGAAGGAGG + Intronic
983037176 4:162881389-162881411 AAGAGGAGATGGAGAAAATGTGG - Intergenic
983648118 4:170012219-170012241 CAGTGGGGAAGGAAAGAAGTTGG + Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984577813 4:181472269-181472291 CAGTGGAGATGGAAACACAGGGG + Intergenic
984596644 4:181676516-181676538 GAGAGGAGAGGGAGAGGAGGGGG - Intergenic
984675125 4:182538698-182538720 TAGTGGAGTTGAAGAGAAGTGGG + Intronic
985184365 4:187299817-187299839 CATTGGAGAAGGTGAGTAGGGGG - Intergenic
985707084 5:1407629-1407651 CACGGGAGATGGGGAGAAGCCGG - Intronic
985880714 5:2636905-2636927 CCATGGAGGTGGGGAGAAGGTGG + Intergenic
986184794 5:5425158-5425180 CAGTGGAGATGTTGAAAAGTGGG - Intronic
986232225 5:5876771-5876793 CAAGGGAGAGAGAGAGAAGGGGG + Intergenic
986346339 5:6838818-6838840 CAGTGGAGATGCTGAGAAGCAGG + Intergenic
986424201 5:7614284-7614306 CAGAGGGGATAGAGAGATGGAGG - Intronic
986533931 5:8766845-8766867 GAGGGGAGATGGAGGGAAGAGGG + Intergenic
987652829 5:20766265-20766287 AAGAGGAGATGAAGAGAAGTTGG + Intergenic
987695731 5:21328957-21328979 CAGTAAAGATGGAGAGAAATAGG + Intergenic
987777402 5:22385849-22385871 CAGGAGAAAGGGAGAGAAGGTGG + Intronic
987960176 5:24796949-24796971 CAGGGGGGAAGGAGGGAAGGAGG - Intergenic
988285999 5:29217133-29217155 CAGTGGAAATGAAGAGCAGCTGG - Intergenic
988555391 5:32232045-32232067 CTTAGGAGATAGAGAGAAGGGGG - Intronic
988742729 5:34095219-34095241 AAGAGGAGATGAAGAGAAGTTGG - Intronic
988807912 5:34757515-34757537 GAATGGAGATGCGGAGAAGGTGG + Exonic
988816844 5:34842573-34842595 CAAAAGAGATGGTGAGAAGGGGG + Intronic
989395425 5:40950840-40950862 CAGTGGAGATGGGGGGAAGGTGG + Intronic
990058563 5:51617756-51617778 TAGAGGAGATGGAGAGAGGTTGG - Intergenic
990140406 5:52696828-52696850 CTATGGAGATGGAGAGGATGGGG - Intergenic
990461850 5:56037980-56038002 CAGGGAAGATGGACAGAGGGAGG - Intergenic
990501256 5:56398638-56398660 CAGTGGAGAGGGAGAGGGAGAGG + Intergenic
990602080 5:57369253-57369275 CTGTAGAGTGGGAGAGAAGGGGG + Intergenic
990816567 5:59792447-59792469 AAGTGGGCATGGAGTGAAGGAGG + Intronic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
990875172 5:60476382-60476404 CAGTGGAGATTGTGAGAGGATGG - Intronic
990973506 5:61536089-61536111 CACTGGAGGCTGAGAGAAGGTGG + Intronic
991254719 5:64601446-64601468 CAGTGGAGAAGAAAGGAAGGTGG + Intronic
991432433 5:66562357-66562379 AAGTGGAGACTGAGGGAAGGAGG - Intergenic
991744670 5:69723135-69723157 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991753033 5:69832098-69832120 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991796241 5:70302859-70302881 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991802651 5:70388825-70388847 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991824052 5:70598449-70598471 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991832353 5:70707217-70707239 CAGTAAAGATGGAGAGAAATAGG + Intergenic
991888619 5:71302418-71302440 CAGTAAAGATGGAGAGAAATAGG - Intergenic
991984399 5:72269003-72269025 CAGCTCAGATGGGGAGAAGGAGG + Intronic
992192237 5:74304557-74304579 CAGTGGAGAAAGAGGAAAGGAGG + Intergenic
992351966 5:75939362-75939384 CAGGGGAGAGGGAGAGACAGAGG + Intergenic
992388684 5:76310642-76310664 CAATGGAGGTGGTGAGAAAGTGG + Intronic
992736835 5:79730199-79730221 CAGTGTCAAAGGAGAGAAGGAGG + Exonic
992902995 5:81317639-81317661 CAGGAGAGATAGAGTGAAGGGGG + Intergenic
994021054 5:95026477-95026499 CAATGGAGATAGAGAGTAGAAGG - Intronic
994038109 5:95225799-95225821 GAAGGGAGATGGAGAGAAGAGGG - Intronic
994681626 5:102894880-102894902 CAGTAGAGAAGGAGAAAAGAGGG - Intronic
994749090 5:103716488-103716510 TAGGGGATATGGAAAGAAGGGGG - Intergenic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
997202254 5:132018052-132018074 CAGTACAGAGGGAGAGAAGAGGG + Intergenic
997578004 5:134997555-134997577 CACTGGATTTGGAGACAAGGAGG - Intronic
997713962 5:136028756-136028778 CTGTGGCGAGGGAGAGAGGGAGG + Intergenic
997976776 5:138445666-138445688 CAGTGGCTGTGGAAAGAAGGAGG - Exonic
998004167 5:138646354-138646376 CAGTGAGGATGGAGAGAGAGCGG - Intronic
998145429 5:139725100-139725122 CACTGGAGATGGACTGCAGGAGG - Intergenic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998405271 5:141870683-141870705 CAGGGGAGATGGGCAGAAGAAGG - Intronic
998887995 5:146714823-146714845 CAGGGGAGAGGGAGAGAATAAGG - Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999282037 5:150372318-150372340 CACTGGAGTTGGGGAGAGGGAGG + Intronic
999719565 5:154388929-154388951 GAGTGGGGAGGGAGAGAGGGAGG + Intronic
1000266912 5:159646877-159646899 GAGTGGGGAAGGAGAGAATGGGG - Intergenic
1001004884 5:168041438-168041460 GAGTGGAGTTAGTGAGAAGGAGG - Intronic
1001200331 5:169710249-169710271 CAGTGGAAATGGAGGCCAGGTGG + Intronic
1001237454 5:170042264-170042286 GAATGGAGATGGAGAGGAAGTGG - Intronic
1001284385 5:170411913-170411935 CAGGGTAGATGGAGAGAGAGAGG + Intronic
1001465906 5:171965973-171965995 CAGGAGAGAGGGTGAGAAGGGGG - Intronic
1001528273 5:172444658-172444680 CAGTGGAGATGGAGGGAGAGAGG - Intronic
1001680375 5:173552728-173552750 GAGTGGAGATGGAGAACAGCTGG - Intergenic
1001727760 5:173921423-173921445 CAGAGGAAATGGTGAGGAGGAGG + Intronic
1001734622 5:173988660-173988682 CAGGGGAGATGGAGGGAAGTGGG - Intronic
1001824355 5:174733478-174733500 CAGTGGAGACGGAGTGGGGGTGG - Intergenic
1001848254 5:174940497-174940519 GGATGGAGATGGAGAGAAGGAGG + Intergenic
1002026078 5:176397132-176397154 CGGAGGAGATGGAGATAAGGAGG - Intronic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002295373 5:178227834-178227856 CCATGGAGATGGAGAGGTGGAGG + Intronic
1002364415 5:178698968-178698990 CTGTGGAAATGAAGAGATGGTGG - Intergenic
1002379304 5:178814230-178814252 CCGTTGAGAGGGAGAGAAGGGGG - Intergenic
1002533895 5:179865611-179865633 CAGGGCAGCTGGAGAGAAGCTGG + Intronic
1002606404 5:180385367-180385389 CGGTGGAGATGGGGAGAAGATGG + Intergenic
1002706974 5:181168018-181168040 CAGTAGAGGTGGGGAGTAGGGGG - Intergenic
1002736685 5:181394985-181395007 TAGTGGAAATAGAGATAAGGAGG - Intergenic
1002748015 6:79838-79860 TAGTGGAAATAGAGATAAGGAGG + Intergenic
1002805173 6:567009-567031 CAGTGGAGTTGGAGAGCAGTTGG - Intronic
1003173189 6:3736226-3736248 CAGGGGAGAAGGAGGGATGGAGG - Intronic
1003226504 6:4210875-4210897 CAGTGGAGAGTGAGCCAAGGTGG - Intergenic
1003426824 6:6003362-6003384 CAGGGGAGGAGGAGAGAAAGAGG - Intronic
1003682399 6:8269040-8269062 CAGTGGTGATGGAGAAAACCAGG + Intergenic
1003722078 6:8715032-8715054 CAGTGCAGATGGAGAACAGAAGG - Intergenic
1004287938 6:14339867-14339889 CAGTGCAGCTGGAGAGAGTGTGG + Intergenic
1004696643 6:18040263-18040285 TGGTGGTGATGGAGACAAGGGGG + Intergenic
1005390928 6:25332419-25332441 CAGTGAAGGTGTAGAGAAGTGGG + Intronic
1005529706 6:26690473-26690495 GAGTGGAGATGGAAAGAAAAGGG + Intergenic
1005541090 6:26811174-26811196 GAGTGGAGATGGAAAGAAAAGGG - Intergenic
1005555054 6:26969109-26969131 CAGTAAAGATGGAGAGAAATAGG - Intergenic
1005587330 6:27289337-27289359 CAGTGTGGTTGGAGAGAAAGGGG - Intronic
1005676226 6:28158246-28158268 CAGTGGAGAAGAGGAGAAAGGGG - Exonic
1006026666 6:31151332-31151354 CAGTGGAGACGGAGACAGAGAGG - Intronic
1006042392 6:31267221-31267243 CAGTGGAGATGGGGAGACTCTGG - Intergenic
1006051979 6:31352309-31352331 CAGTGGAGATGGGGAGACTCTGG - Intronic
1006576539 6:35050678-35050700 CTGTGCAGATGGGGAGAAGCCGG - Intronic
1006748607 6:36362679-36362701 CTGGGGAGATGGAGAAAAGGTGG + Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006938880 6:37738203-37738225 CAGTGGGGAGGGTGAGAAGGGGG + Intergenic
1007463511 6:42035322-42035344 CAGTAGAAATGGAAACAAGGGGG - Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008245769 6:49171034-49171056 AAGAGGGGATGGAGAGGAGGTGG + Intergenic
1008356898 6:50565663-50565685 CAGTGGCTATGGAGAGCCGGAGG - Intergenic
1008501307 6:52185678-52185700 TGATGGAGATGGAGAAAAGGGGG - Intergenic
1008555918 6:52672736-52672758 CAATGAGAATGGAGAGAAGGTGG - Intronic
1008626934 6:53326268-53326290 ATGTGGAGGTGGATAGAAGGAGG - Intronic
1008632367 6:53374719-53374741 GAGTTGAGATTAAGAGAAGGAGG - Intergenic
1008664007 6:53697894-53697916 CAGTGAGGATGGAGAGGAAGAGG + Intergenic
1008872347 6:56287520-56287542 CAGGAGAGAAAGAGAGAAGGGGG - Intronic
1009011903 6:57853262-57853284 GAGTGGAGATGGAAAGAAAAGGG - Intergenic
1009609070 6:65914822-65914844 TAGTGGAGATTGAGAGGAGTTGG - Intergenic
1009977723 6:70690852-70690874 CAGTGGGGAAGGGGGGAAGGGGG - Intronic
1010016585 6:71111174-71111196 TATTGGAGATGGAGAGAAAATGG - Intergenic
1010116174 6:72315273-72315295 TAGTGAAGATGGTGAGAAGAGGG + Intronic
1011249921 6:85360295-85360317 CTGAGGAGCTGGAGAGAAGTTGG + Intergenic
1011740095 6:90350867-90350889 CAGAGGAGAGGGAGGGAGGGAGG - Intergenic
1012143790 6:95656141-95656163 AAGTGGGGATGGAGAAAAGGTGG - Intergenic
1012200623 6:96402007-96402029 CAGGAGAGAGAGAGAGAAGGGGG - Intergenic
1012241253 6:96875505-96875527 CAGTAGAAATGGAGAAAAGATGG - Intergenic
1012791643 6:103705816-103705838 CCATGAAGATTGAGAGAAGGTGG + Intergenic
1013453533 6:110308946-110308968 GACTGGGGATGGAGAGAAGAGGG + Intronic
1013473287 6:110485315-110485337 TGGTGGAGATGTGGAGAAGGTGG - Intergenic
1013580582 6:111530297-111530319 GAGTGGGGAGGGAGAGAGGGAGG - Intergenic
1013758461 6:113488103-113488125 CAGAGGAGAGAGAGAAAAGGGGG - Intergenic
1014023428 6:116616892-116616914 CAGGGGAGAAGGAGAGGAAGAGG - Exonic
1015495984 6:133883872-133883894 CAGAGGAAATGGTGAGAAGAGGG + Intergenic
1015598076 6:134885144-134885166 GAGGGGAGATGGAGAGAGGGGGG + Intergenic
1015789433 6:136951535-136951557 CTGTTAAGATGGAGTGAAGGAGG - Intergenic
1015888661 6:137946864-137946886 AAGTGGAGATGGATACAAGGGGG - Intergenic
1016099636 6:140082744-140082766 CAATGGAAATGGTGAGAAGAAGG + Intergenic
1016292107 6:142537694-142537716 CAGTTGAGAGGGAGAGGTGGGGG - Intergenic
1016471469 6:144379105-144379127 CAGTGGAGATGTCAAGTAGGTGG + Intronic
1016604726 6:145907295-145907317 CGGTAGAAATGGAGAGAAGTGGG - Intronic
1016692269 6:146951291-146951313 CAGAGGAGATGGAGACAGAGTGG - Intergenic
1016912598 6:149214158-149214180 CAGTGAAGATGGAGAAGAGCAGG - Intergenic
1017043464 6:150325920-150325942 CAGGGGAGGTGGTGAGAAGTGGG + Intergenic
1017165877 6:151408062-151408084 CAGTGGACATGAAGAAAAGGTGG + Intronic
1017493238 6:154962347-154962369 CAGGGTAGAAGGAGAGAGGGAGG + Intronic
1017612846 6:156209473-156209495 GAGGGGAGATGAAGAGAAGCTGG - Intergenic
1018353599 6:162989096-162989118 CAGTGAGAATGTAGAGAAGGGGG + Intronic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1018950859 6:168378020-168378042 CTGTGGAGAAGGAGAAACGGGGG - Intergenic
1018988826 6:168658097-168658119 ATGGGGAGATGGAGAGCAGGTGG + Intronic
1019106640 6:169673119-169673141 CAATGGATATGGAGGGATGGAGG + Intronic
1019241783 6:170670514-170670536 TAGTGGAAATAGAGATAAGGAGG - Intergenic
1019417242 7:933470-933492 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417253 7:933500-933522 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417269 7:933537-933559 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417300 7:933627-933649 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417311 7:933657-933679 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417322 7:933687-933709 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417353 7:933777-933799 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417394 7:933897-933919 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417415 7:933957-933979 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417426 7:933987-934009 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417465 7:934107-934129 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417486 7:934167-934189 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019417497 7:934197-934219 CAGTGGTGCTGGAGAGCCGGGGG + Intronic
1019471879 7:1225367-1225389 CAGGGGAGAGGGAGGGAGGGAGG + Intergenic
1019517423 7:1446184-1446206 GAGTGAAGAGGGAGAGGAGGGGG + Intronic
1019517480 7:1446328-1446350 GAGTGAAGAGGGAGAGGAGGGGG + Intronic
1019517519 7:1446434-1446456 GAGTGAAGAGGGAGAGGAGGGGG + Intronic
1019612820 7:1945580-1945602 CCCTGGAGATGAAGGGAAGGAGG + Intronic
1019804757 7:3115473-3115495 CAGAATAGGTGGAGAGAAGGGGG + Intergenic
1019888252 7:3924182-3924204 CATTGGGGATGGGGAAAAGGTGG + Intronic
1020111900 7:5452188-5452210 CAGTGCAGATGGGGAGACTGAGG - Intronic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020442012 7:8227352-8227374 CAGAGAAGATGGAGAGAGGAAGG + Intronic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1021602064 7:22374054-22374076 GTGAGGAGATGGTGAGAAGGTGG - Intergenic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1021801063 7:24306752-24306774 CAGATGAGATAGAGAGAAGCTGG + Intergenic
1021905799 7:25331910-25331932 CATTAGAGATGAAGAAAAGGAGG - Intergenic
1021946286 7:25731002-25731024 CAGTAGAGATGGAAAAAAGTGGG - Intergenic
1022097213 7:27148411-27148433 TAGCGGAGAAGGAGAGAATGAGG - Intronic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022483962 7:30763506-30763528 CAGGGGAGAGGGAGAGCAAGAGG + Intronic
1022632082 7:32094814-32094836 AGATGGAGCTGGAGAGAAGGTGG - Intronic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1022958846 7:35405915-35405937 CAGGAGAGAAAGAGAGAAGGGGG - Intergenic
1023636572 7:42217232-42217254 CATGGGAGCAGGAGAGAAGGAGG + Intronic
1023765362 7:43505332-43505354 CAGTGGAGATGAAGTGAAGTGGG - Intronic
1024089798 7:45925824-45925846 CACTGGAGATGGAGAGACGGAGG + Intergenic
1024280933 7:47719167-47719189 CTTTGGAGTTGGAGAGAATGTGG + Intronic
1024454638 7:49589896-49589918 CAGTGGAGATGTAGAGAAATTGG + Intergenic
1024657514 7:51464206-51464228 GGATGGAGATGGAGAGAAGTGGG + Intergenic
1024741595 7:52360854-52360876 CAGATGAGAAGGAGAGAAGGTGG - Intergenic
1024777323 7:52802649-52802671 CAGTGGAATAGGAGAGAAGATGG - Intergenic
1024883888 7:54119693-54119715 CAGTGGAAGTGGAGAAATGGAGG - Intergenic
1025187767 7:56874401-56874423 CAGAGGACCTGGAGAGGAGGTGG + Intergenic
1025279803 7:57619067-57619089 CAGAGGAGACAGAGAGCAGGAGG - Intergenic
1025304929 7:57846434-57846456 CAGAGGAGACAGAGAGCAGGAGG + Intergenic
1025684155 7:63702525-63702547 CAGAGGACCTGGAGAGGAGGTGG - Intergenic
1026004635 7:66591569-66591591 CAGTTGAGGGAGAGAGAAGGGGG - Intergenic
1027279701 7:76598755-76598777 TAGTGGAGTTGCAGAGAATGGGG + Intergenic
1027306897 7:76907922-76907944 CAAAGGAGAAGAAGAGAAGGAGG - Intergenic
1027634179 7:80648890-80648912 CAGTGAAGATGGAAGGAAGAAGG + Intronic
1028072847 7:86473879-86473901 GAATGGAGAGGGAGGGAAGGAGG - Intergenic
1028573165 7:92314914-92314936 TACTGGAGATGGAAAGAATGAGG + Intronic
1028718688 7:94004222-94004244 CAGAGGAGAGAGAGAAAAGGCGG + Exonic
1028987194 7:97017816-97017838 CAATGGAGAGGAAGAGAAGGTGG + Intergenic
1028988330 7:97024742-97024764 AAGAGGAGGAGGAGAGAAGGAGG + Exonic
1029173360 7:98646292-98646314 CAGTGGAGATGGAAATGGGGAGG - Intergenic
1029876905 7:103763907-103763929 CAGTGGGCATGGAAAGAAAGGGG + Intronic
1030109853 7:106017901-106017923 CAGTGGAGATGGAGTACAGGAGG - Exonic
1030124521 7:106141588-106141610 AAGGGGAGAAGGGGAGAAGGGGG - Intergenic
1030200170 7:106895223-106895245 CAGTTGAGAAGGAGAGAATGAGG + Intronic
1031132102 7:117844355-117844377 AAGTGGAGATGGGGTGAAGCAGG + Intronic
1031378170 7:121052623-121052645 CAATGGAGAAGGTGAGAAGGGGG + Intronic
1031943599 7:127815511-127815533 GAGGGGAGAAGAAGAGAAGGAGG + Intronic
1031993016 7:128210146-128210168 AAGGAGAGAAGGAGAGAAGGAGG + Intergenic
1032166953 7:129552999-129553021 GTGTGGGGATGGAGAGGAGGTGG - Intergenic
1032169484 7:129572641-129572663 TAGTGGGGATGGAGAGATGTTGG + Intergenic
1032441703 7:131947268-131947290 CTCTGGAGAAGGAAAGAAGGAGG + Intergenic
1032478091 7:132225962-132225984 CAGAGGAGAGGGAGTGAGGGAGG + Intronic
1032478107 7:132226025-132226047 CAGAGGAGAGGGAGTGAAGGAGG + Intronic
1032503472 7:132417717-132417739 GAGGGGAGAGGGAGAGACGGAGG + Intronic
1032523316 7:132562106-132562128 AGGAGGAGAAGGAGAGAAGGAGG - Intronic
1032523320 7:132562126-132562148 AGGAGGAGAAGGAGAGAAGGAGG - Intronic
1032523324 7:132562146-132562168 AGGAGGAGAAGGAGAGAAGGAGG - Intronic
1032525951 7:132578119-132578141 CAGTGAAGATGGGGAGTGGGTGG + Intronic
1032526526 7:132581956-132581978 AAGGGGAGATGGAGGGAGGGAGG + Intronic
1032586345 7:133150614-133150636 CACTGGAGATAGAAAGAAAGTGG - Intergenic
1032607037 7:133366932-133366954 CCGTGGCAATGGAGTGAAGGAGG + Intronic
1032728708 7:134616304-134616326 GAGTGAAGTTAGAGAGAAGGTGG + Intergenic
1032870226 7:135977205-135977227 GAGAGGAGAAGAAGAGAAGGAGG + Exonic
1033327611 7:140392474-140392496 CAGTGAGGATGGAGAGAAGAGGG - Intronic
1033422838 7:141218332-141218354 CAGTGGGGATGGAGGAAGGGAGG + Intronic
1034469203 7:151246649-151246671 CTGTGGAGACTGAGAGGAGGCGG + Intronic
1035120233 7:156560626-156560648 CGGAGGAGATGGAGACAGGGAGG - Intergenic
1035173465 7:157033753-157033775 CCGTGCAGATGGACAGAAAGGGG - Intergenic
1035447469 7:158952604-158952626 CTGTGGACAGGGAGAAAAGGAGG + Intronic
1035506333 8:137582-137604 TAGTGGAAATAGAGATAAGGAGG + Intergenic
1036208642 8:6824304-6824326 AGGTGGGGAGGGAGAGAAGGGGG + Intronic
1036400052 8:8400103-8400125 GAGGGGAGAAGGGGAGAAGGGGG - Intergenic
1036445324 8:8817156-8817178 CAGTTTAGATGGAGAGAGGATGG - Intronic
1036485211 8:9173202-9173224 CAGTTGAGATGGAAAGAAAGTGG - Intergenic
1036690426 8:10941399-10941421 CTGTGGAGATGGAGAAACTGAGG + Intronic
1036757639 8:11481783-11481805 CAATGGAGATGGGGAAAAGTGGG + Intergenic
1036778269 8:11628456-11628478 CAGTAGGGATGCAGGGAAGGGGG + Intergenic
1037376126 8:18230987-18231009 AGGTGGGGATGTAGAGAAGGTGG + Intergenic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1037802661 8:22043913-22043935 CACTGGATATGAAGAGAAGCGGG - Intronic
1038318392 8:26507505-26507527 GAGGAGAGAAGGAGAGAAGGAGG + Exonic
1038440671 8:27569074-27569096 CAGTAGAGATGGGGAAAGGGAGG - Intergenic
1039103747 8:33967925-33967947 CAGTGGGGATGGAGCCAAGATGG - Intergenic
1039398162 8:37245144-37245166 TGGTGGAGATGGAGAGCAGCAGG + Intergenic
1039706857 8:40016105-40016127 CAGTGGAGATGGGAAGATAGAGG + Exonic
1039759417 8:40558434-40558456 CAGGGGAAAGGGAGAAAAGGGGG + Intronic
1040685823 8:49871653-49871675 CTGAGGAGAAGGAGAGATGGGGG + Intergenic
1041508865 8:58632524-58632546 CAGTGAGGTTGGAGAGAAGCAGG - Intronic
1041523463 8:58779736-58779758 AGGTGGAGATGAAGAGAAGTAGG - Intergenic
1041878226 8:62715084-62715106 CAGAGGAGAGAGAGAGAAGTAGG + Intronic
1042016138 8:64314623-64314645 CAGCAGAGAGGGAGAGAAGTGGG + Intergenic
1043291513 8:78607579-78607601 TAGTGGAGAGGTAGACAAGGAGG - Intergenic
1043416638 8:80057667-80057689 AAGTGGAGAGGGAGAGTTGGGGG + Intronic
1043918685 8:85955259-85955281 GAGTGGAGAAGGAGGGAGGGGGG + Intergenic
1044094977 8:88052412-88052434 CAGTGGAGATGGAGCAAAGTGGG - Intronic
1044604819 8:94039433-94039455 CAGTGGAGATGGAGAGAGATGGG + Intergenic
1044693352 8:94899983-94900005 CAATGGAGGTGGGGAGAATGAGG - Intronic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045063998 8:98429272-98429294 CTTTGGAGATGGAATGAAGGAGG + Exonic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045863622 8:106840256-106840278 CAATGAGGATGGAGAGAAGATGG - Intergenic
1046091980 8:109513813-109513835 CAGTGGAGGTGGTGAGAAGTGGG - Intronic
1046120858 8:109844981-109845003 GAGTGGAGATGAAGAGAGGTTGG - Intergenic
1046780164 8:118206146-118206168 CATTGGAAATGGAGACAAGCTGG - Intronic
1046905902 8:119572893-119572915 TACTGGAAATGGAGTGAAGGTGG + Intronic
1047030921 8:120879833-120879855 CAGTGGACCTGGAGAGAAGTTGG + Intergenic
1047072808 8:121365994-121366016 TCGTGGACATAGAGAGAAGGAGG + Intergenic
1047338112 8:123955276-123955298 CAGTGGGTGGGGAGAGAAGGAGG + Intronic
1047438889 8:124858802-124858824 CAGAGGTGATGGAGAGGAAGTGG - Intergenic
1047634485 8:126744996-126745018 CAGTGAAGATGAAGAAAAGTAGG + Intergenic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1047939777 8:129818086-129818108 CAGGAGAGATGGAGAGATGTAGG - Intergenic
1048001992 8:130386205-130386227 CAGTGGTGATGCAGAGAAAAGGG + Intronic
1048008759 8:130440120-130440142 CAATGGAGGTAGAGAGAAGTGGG - Intronic
1048065140 8:130960114-130960136 CAGTGGAGATGGAGAAACATGGG + Intronic
1048204437 8:132404019-132404041 CTGTGGAGATGTACAGAATGGGG - Intronic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048299246 8:133239260-133239282 GAGTGGACATGGAGAGGACGGGG - Intronic
1048497711 8:134948811-134948833 CAGGGAAGATGAAGAGAAGGAGG - Intergenic
1048748983 8:137649606-137649628 AAGAGGAGATGGAAAGAAGGAGG + Intergenic
1048777569 8:137964184-137964206 CGGTGAAGATGAAGAGATGGTGG + Intergenic
1049032955 8:140050691-140050713 GATGGGAGATGGAGAGATGGGGG + Intronic
1049070145 8:140349599-140349621 CAGTGGGGTGGGAGAGAGGGAGG + Intronic
1049151359 8:141037463-141037485 CAGGGGAAACGGGGAGAAGGGGG - Intergenic
1049292221 8:141810255-141810277 CAGTGGTGGTGGAGGCAAGGCGG + Intergenic
1049386055 8:142343737-142343759 CAGTGGTGATGGGGAGTGGGGGG + Intronic
1049405652 8:142450831-142450853 CAGTGGAAAGGTAGACAAGGAGG - Intronic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1049476740 8:142800387-142800409 CAGTGGGGCTGGAGACAGGGGGG - Intergenic
1049533746 8:143168612-143168634 AAGTGGAGAGGGAAAGAAAGAGG + Intergenic
1050021608 9:1290495-1290517 TAGTGGAGAAGGAGAGGAGAAGG - Intergenic
1050085068 9:1956562-1956584 AAGAGGAGATGGAGAGAGGTTGG + Intergenic
1050580041 9:7044494-7044516 CAGTGATGATGGAGAGAACAGGG + Intronic
1050707188 9:8414860-8414882 CAGGGGAGCAGGAGAGAGGGAGG + Intronic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1051355360 9:16235294-16235316 CAGCGGAGATGGTGGGAAGGGGG - Intronic
1051627631 9:19113497-19113519 GAGTTGAGTTGGAGAGTAGGTGG - Intronic
1052074519 9:24124472-24124494 CAGCTGAGAAGCAGAGAAGGAGG - Intergenic
1052865381 9:33461882-33461904 CAGTGGGGTTGCAGAGATGGGGG - Exonic
1052977712 9:34423756-34423778 CAGTGGGGTTGGAAAAAAGGAGG + Intronic
1053025012 9:34722217-34722239 CAGTAGAGAGGGTGAGAAGTGGG + Intergenic
1053266955 9:36722088-36722110 CATTGGGGATGAAGAAAAGGCGG + Intergenic
1054864709 9:69988127-69988149 CAGAGGAGATGTTGAGATGGAGG + Intergenic
1054957758 9:70932933-70932955 CAGAAGAGATGGTGAGAAGTAGG + Intronic
1055293883 9:74814261-74814283 CCATGGAGATGGAGAGCAGAAGG + Intronic
1055760458 9:79601679-79601701 CTGAGGAGAGGGAAAGAAGGGGG - Intronic
1056139128 9:83657480-83657502 CAGTGGAGGTGGTAAGAAGTTGG - Intergenic
1056182849 9:84102389-84102411 CAGTGAGGAGGGAAAGAAGGAGG + Intergenic
1056277075 9:85003803-85003825 CAGTGAAGATGGGGGGAATGGGG + Intronic
1057283933 9:93732689-93732711 CAGGGGGGAGGGAGAGAGGGAGG + Intergenic
1057407224 9:94783596-94783618 CAGTGGAGAAGGAGGCCAGGAGG + Intronic
1057725438 9:97564903-97564925 AAGTGGAGAAGGAAAGAAAGTGG - Intronic
1057787319 9:98096709-98096731 CAGTGGGGATGGGGAGAAACAGG - Intronic
1057918318 9:99074771-99074793 CTGAGGAGGTGGAGAGCAGGTGG - Intergenic
1057919327 9:99083760-99083782 CAGTGGATGTGGTGAGAAGTGGG + Intergenic
1057970628 9:99554029-99554051 CAAGAGAGAGGGAGAGAAGGGGG + Intergenic
1058288452 9:103209099-103209121 CAGGGGAGACAGAGAGAAGGGGG + Intergenic
1058299877 9:103358731-103358753 CAGGAGAGAAAGAGAGAAGGGGG + Intergenic
1058732292 9:107861922-107861944 AAGAGCAGATGGAGAGAAGTGGG + Intergenic
1058843747 9:108934964-108934986 CAGTAGGGATGGCGAGAAGAGGG + Intronic
1058935163 9:109763306-109763328 CTATGGAGATGGAGAGAAAAGGG - Intronic
1059368043 9:113801813-113801835 CTGGGGTGAGGGAGAGAAGGCGG + Intergenic
1059710956 9:116867260-116867282 CCGAGGAGAGGGAGAGAAGGTGG + Intronic
1059764043 9:117366548-117366570 CAGAGGAGTTAGAGAGAGGGGGG - Intronic
1059853450 9:118368749-118368771 ATGGGGAGAGGGAGAGAAGGAGG + Intergenic
1060041363 9:120304352-120304374 CCGTGGAGATGGAGAGGGAGAGG - Intergenic
1060100345 9:120834864-120834886 CAGTGAGGATAGAGAGAAGAGGG + Intronic
1060273414 9:122164251-122164273 GGGAGGAGAAGGAGAGAAGGAGG + Intronic
1060550683 9:124483640-124483662 CAGTGATGATGGAGACAAGATGG - Intronic
1060730882 9:126036277-126036299 CAGTGGAGGTGGGGACAAGAGGG - Intergenic
1060956829 9:127647589-127647611 CAGAGGAGATGGTGAGAAGTGGG - Intronic
1061268530 9:129522797-129522819 CAGGGGAGGAGGAGAGATGGAGG - Intergenic
1061271281 9:129544840-129544862 CTGGGGAGGTGGAGAGTAGGAGG - Intergenic
1061344443 9:130011029-130011051 CAGCAGAGATGGAAGGAAGGTGG + Intronic
1061414902 9:130442337-130442359 AAGTGGAAGTGGAGAGAAAGGGG + Intergenic
1061429478 9:130522257-130522279 CAGGAGTGAGGGAGAGAAGGGGG + Intergenic
1061996638 9:134189512-134189534 GAGTGGAGAGGCAGAGAGGGCGG + Intergenic
1062170713 9:135133289-135133311 CAGGCGAGCTGGAGAGAAGGGGG + Intergenic
1062362757 9:136195450-136195472 CAGTGGACGGGGAGGGAAGGTGG - Intergenic
1062703542 9:137921123-137921145 AAGTGCAGATGGAGAAAAGAAGG + Intronic
1062722450 9:138051472-138051494 AAGGGGAGAGGGAGGGAAGGAGG - Intronic
1203776435 EBV:75693-75715 CTGTGGTGAGGGATAGAAGGGGG + Intergenic
1203601974 Un_KI270748v1:19748-19770 TAGTGGAAATAGAGATAAGGAGG - Intergenic
1185830193 X:3294286-3294308 AGGAGGAGAAGGAGAGAAGGAGG - Intergenic
1186162172 X:6788960-6788982 CCATGCAGATGCAGAGAAGGTGG + Intergenic
1186380304 X:9051430-9051452 AGGTAGAGATGCAGAGAAGGAGG + Intronic
1186490810 X:9970570-9970592 AAGTAGGGAGGGAGAGAAGGAGG - Intergenic
1187408888 X:19029840-19029862 CAGAGAGGAGGGAGAGAAGGAGG + Intronic
1187454550 X:19429706-19429728 AAGTGTGGATGGAGAGAAGGTGG + Intronic
1187715888 X:22102201-22102223 CAGAGGGGAAGGAGGGAAGGAGG - Intronic
1187915434 X:24149423-24149445 CGGAGGAGGTGGAAAGAAGGGGG + Intronic
1187984662 X:24797217-24797239 CAGGGGAAATGGAGAGAGGGTGG - Intronic
1188025378 X:25202801-25202823 CAGTGGAGAATGAGTAAAGGAGG + Intergenic
1188250440 X:27887115-27887137 AAGTGGGGAAGGTGAGAAGGAGG - Intergenic
1188305935 X:28559750-28559772 CAGGTGAGAGAGAGAGAAGGAGG + Intergenic
1188520343 X:31031581-31031603 GAGTGGTGATAGAGAGAAGCAGG + Intergenic
1188889499 X:35592841-35592863 GAGTGGGGAAGGAGTGAAGGGGG - Intergenic
1189181420 X:39008250-39008272 AAGGGGAGAGGGAGAGAAAGGGG + Intergenic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1189372380 X:40439031-40439053 AAGTGGAGAGGGAGGGAAAGGGG + Intergenic
1189570405 X:42289892-42289914 CAGAGGAGACAGAGAGAAAGAGG - Intergenic
1189778070 X:44487900-44487922 GAGGGGAGAAGGAGAGAAGCTGG + Intergenic
1189809954 X:44772713-44772735 TAGTGGTGATGGAGAGAAAAAGG - Intergenic
1189900363 X:45700173-45700195 CAGTGGATAAGGAAAGAGGGTGG + Intergenic
1189901433 X:45710890-45710912 GAGAGGAGGTGGAGAGATGGGGG - Intergenic
1190073829 X:47300948-47300970 AAGAGGAGAAGGAGAGGAGGAGG + Intergenic
1190151215 X:47950912-47950934 AAGAGGAGAAGGAGAAAAGGAGG + Intronic
1190335464 X:49259073-49259095 CAGTGGAGAAGGCGAGAAGTGGG + Intronic
1190429843 X:50368511-50368533 CCAGGGAGATGAAGAGAAGGGGG - Exonic
1190472612 X:50798040-50798062 GAGGGGAGAGGGAGAGAGGGAGG + Intronic
1191053189 X:56216143-56216165 AAGTGAAGATGAAGAGAAGTAGG - Intergenic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191767841 X:64719817-64719839 CAGTCAGGATGGAAAGAAGGTGG - Intergenic
1191911774 X:66159337-66159359 CGGTGGAGATAGAGAGAAGTGGG + Intergenic
1192163193 X:68803982-68804004 CAGTGAGAATGGAGAGGAGGGGG + Intergenic
1192571461 X:72209604-72209626 TAGTAGAGATGGAAAGAAGGTGG - Intronic
1193517774 X:82490929-82490951 CAGGGGAAAGGGGGAGAAGGTGG + Intergenic
1193740033 X:85205892-85205914 CAATGGAGATAGAGAGAAGTGGG + Intergenic
1194409954 X:93544999-93545021 CAGGGGAGAGAGAGAGAAGGGGG + Intergenic
1194568309 X:95521494-95521516 CAGTAGAAAGGGAGAAAAGGAGG + Intergenic
1195077149 X:101338096-101338118 AAGCAGAAATGGAGAGAAGGAGG - Intergenic
1195129569 X:101839759-101839781 AGGTGGAGAAGGAGGGAAGGTGG + Intronic
1195176670 X:102320070-102320092 AGGTGGAGAAGGAGGGAAGGTGG - Intronic
1195182194 X:102367023-102367045 AGGTGGAGAAGGAGGGAAGGTGG + Intronic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1195229722 X:102834026-102834048 GAGTGGAGATGGGGGGAAGAGGG - Intergenic
1195254915 X:103081540-103081562 AGGTGGAGAAGGAGGGAAGGAGG + Intronic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195598918 X:106724254-106724276 TAGTGGACATGAAGAGAAGTGGG - Intronic
1195910064 X:109880450-109880472 CAGAGGAGATGGGGAGAAGCAGG - Intergenic
1196035151 X:111135939-111135961 CAGTAGAGAGGGAGAGATTGAGG + Intronic
1196649010 X:118149851-118149873 CAGTGGATACGGGGAGAAGATGG - Intergenic
1196978951 X:121190653-121190675 CAGTGGGCAAGGAGTGAAGGTGG - Intergenic
1197209377 X:123816519-123816541 AAGAAGAGAAGGAGAGAAGGTGG + Intergenic
1197452163 X:126632785-126632807 TCATGGAGATGGAGAGAAGAAGG - Intergenic
1197906078 X:131427265-131427287 GAGAGGAGGAGGAGAGAAGGAGG - Intergenic
1198080802 X:133237420-133237442 CGGTGGGGAGGAAGAGAAGGAGG + Intergenic
1198131302 X:133697920-133697942 CAGAGGGGAAGGAGAGGAGGGGG + Intronic
1198134673 X:133736718-133736740 CAGGGGAGATGGAGAGTAATAGG + Intronic
1198618584 X:138482863-138482885 CAGAGTAGAGGGAGAGGAGGAGG - Intergenic
1199128768 X:144159028-144159050 TAATGGAGATAGAGAGTAGGAGG + Intergenic
1199226100 X:145376536-145376558 TAGTAGAGATGGAGACAAGGAGG + Intergenic
1199259783 X:145758986-145759008 AAGTGGACAGGGAGAGAAGCAGG + Intergenic
1199497451 X:148468776-148468798 AAGTGGAGTTGGAAAGAAAGAGG + Intergenic
1199599774 X:149535045-149535067 GAGAGGAGAAGGAGAGCAGGAGG - Intergenic
1199650774 X:149944769-149944791 AAGAGGAGAAGGAGAGGAGGGGG + Intergenic
1199650865 X:149945202-149945224 GAGAGGAGAAGGAGAGCAGGAGG + Intergenic
1199686702 X:150271591-150271613 CAGTGGAGGTGGAGACAAGTGGG + Intergenic
1200722711 Y:6626230-6626252 TGGGGGAGATGGAAAGAAGGAGG + Intergenic
1202344484 Y:23907022-23907044 CACTGGAAAAGGAGAGATGGGGG - Intergenic
1202526284 Y:25763061-25763083 CACTGGAAAAGGAGAGATGGGGG + Intergenic