ID: 1191069004

View in Genome Browser
Species Human (GRCh38)
Location X:56380362-56380384
Sequence TCTCAGATGGGGCAGCTGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6805
Summary {0: 20, 1: 340, 2: 723, 3: 1614, 4: 4108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191068996_1191069004 15 Left 1191068996 X:56380324-56380346 CCAGACGGGGTGGTTGCCAGGCG No data
Right 1191069004 X:56380362-56380384 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108
1191068998_1191069004 -1 Left 1191068998 X:56380340-56380362 CCAGGCGGAGACACTCCTCACTT 0: 35
1: 1548
2: 4081
3: 4788
4: 8683
Right 1191069004 X:56380362-56380384 TCTCAGATGGGGCAGCTGCCGGG 0: 20
1: 340
2: 723
3: 1614
4: 4108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191069004 Original CRISPR TCTCAGATGGGGCAGCTGCC GGG Intergenic
Too many off-targets to display for this crispr