ID: 1191073016

View in Genome Browser
Species Human (GRCh38)
Location X:56421765-56421787
Sequence CTGGGGGGATGGAGCCAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191073016_1191073024 -4 Left 1191073016 X:56421765-56421787 CCATCTTGGCTCCATCCCCCCAG No data
Right 1191073024 X:56421784-56421806 CCAGGCCATCAATTTCACCTTGG No data
1191073016_1191073026 2 Left 1191073016 X:56421765-56421787 CCATCTTGGCTCCATCCCCCCAG No data
Right 1191073026 X:56421790-56421812 CATCAATTTCACCTTGGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191073016 Original CRISPR CTGGGGGGATGGAGCCAAGA TGG (reversed) Intergenic
No off target data available for this crispr