ID: 1191091039

View in Genome Browser
Species Human (GRCh38)
Location X:56621878-56621900
Sequence GCCTTTGTTGGGGCTTGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191091033_1191091039 11 Left 1191091033 X:56621844-56621866 CCCAATTTAATATAGAAATATGA No data
Right 1191091039 X:56621878-56621900 GCCTTTGTTGGGGCTTGAATTGG No data
1191091034_1191091039 10 Left 1191091034 X:56621845-56621867 CCAATTTAATATAGAAATATGAG No data
Right 1191091039 X:56621878-56621900 GCCTTTGTTGGGGCTTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191091039 Original CRISPR GCCTTTGTTGGGGCTTGAAT TGG Intergenic
No off target data available for this crispr