ID: 1191095706

View in Genome Browser
Species Human (GRCh38)
Location X:56671167-56671189
Sequence GACAGTTCTTGGCCTATTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191095706_1191095708 4 Left 1191095706 X:56671167-56671189 CCAGTAATAGGCCAAGAACTGTC No data
Right 1191095708 X:56671194-56671216 AAAAGAAGAGTAGTTATCTGTGG No data
1191095706_1191095709 15 Left 1191095706 X:56671167-56671189 CCAGTAATAGGCCAAGAACTGTC No data
Right 1191095709 X:56671205-56671227 AGTTATCTGTGGAAGATAGCAGG No data
1191095706_1191095710 16 Left 1191095706 X:56671167-56671189 CCAGTAATAGGCCAAGAACTGTC No data
Right 1191095710 X:56671206-56671228 GTTATCTGTGGAAGATAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191095706 Original CRISPR GACAGTTCTTGGCCTATTAC TGG (reversed) Intergenic
No off target data available for this crispr