ID: 1191095709

View in Genome Browser
Species Human (GRCh38)
Location X:56671205-56671227
Sequence AGTTATCTGTGGAAGATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191095706_1191095709 15 Left 1191095706 X:56671167-56671189 CCAGTAATAGGCCAAGAACTGTC No data
Right 1191095709 X:56671205-56671227 AGTTATCTGTGGAAGATAGCAGG No data
1191095707_1191095709 4 Left 1191095707 X:56671178-56671200 CCAAGAACTGTCTTTTAAAAGAA No data
Right 1191095709 X:56671205-56671227 AGTTATCTGTGGAAGATAGCAGG No data
1191095705_1191095709 16 Left 1191095705 X:56671166-56671188 CCCAGTAATAGGCCAAGAACTGT No data
Right 1191095709 X:56671205-56671227 AGTTATCTGTGGAAGATAGCAGG No data
1191095704_1191095709 22 Left 1191095704 X:56671160-56671182 CCAAAGCCCAGTAATAGGCCAAG 0: 17
1: 191
2: 171
3: 92
4: 154
Right 1191095709 X:56671205-56671227 AGTTATCTGTGGAAGATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191095709 Original CRISPR AGTTATCTGTGGAAGATAGC AGG Intergenic
No off target data available for this crispr