ID: 1191095769

View in Genome Browser
Species Human (GRCh38)
Location X:56671614-56671636
Sequence GACTCCTAGAAACTTTACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191095763_1191095769 14 Left 1191095763 X:56671577-56671599 CCTTAGAAGGAATATCTCAACAG 0: 61
1: 97
2: 143
3: 146
4: 223
Right 1191095769 X:56671614-56671636 GACTCCTAGAAACTTTACTGAGG No data
1191095766_1191095769 -10 Left 1191095766 X:56671601-56671623 CCCCACATTACTGGACTCCTAGA No data
Right 1191095769 X:56671614-56671636 GACTCCTAGAAACTTTACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191095769 Original CRISPR GACTCCTAGAAACTTTACTG AGG Intergenic
No off target data available for this crispr