ID: 1191101676

View in Genome Browser
Species Human (GRCh38)
Location X:56736337-56736359
Sequence CCGGGGGGCGGAGGCTGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191101676_1191101688 17 Left 1191101676 X:56736337-56736359 CCACTGCAGCCTCCGCCCCCCGG No data
Right 1191101688 X:56736377-56736399 GCCGCAGCCTCCCAAACAGCTGG No data
1191101676_1191101692 26 Left 1191101676 X:56736337-56736359 CCACTGCAGCCTCCGCCCCCCGG No data
Right 1191101692 X:56736386-56736408 TCCCAAACAGCTGGGACCACCGG No data
1191101676_1191101690 18 Left 1191101676 X:56736337-56736359 CCACTGCAGCCTCCGCCCCCCGG No data
Right 1191101690 X:56736378-56736400 CCGCAGCCTCCCAAACAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191101676 Original CRISPR CCGGGGGGCGGAGGCTGCAG TGG (reversed) Intergenic