ID: 1191101680

View in Genome Browser
Species Human (GRCh38)
Location X:56736346-56736368
Sequence TGCTTGACCCCGGGGGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191101680_1191101692 17 Left 1191101680 X:56736346-56736368 CCTCCGCCCCCCGGGGTCAAGCA No data
Right 1191101692 X:56736386-56736408 TCCCAAACAGCTGGGACCACCGG 0: 18
1: 642
2: 9765
3: 79662
4: 509852
1191101680_1191101690 9 Left 1191101680 X:56736346-56736368 CCTCCGCCCCCCGGGGTCAAGCA No data
Right 1191101690 X:56736378-56736400 CCGCAGCCTCCCAAACAGCTGGG No data
1191101680_1191101688 8 Left 1191101680 X:56736346-56736368 CCTCCGCCCCCCGGGGTCAAGCA No data
Right 1191101688 X:56736377-56736399 GCCGCAGCCTCCCAAACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191101680 Original CRISPR TGCTTGACCCCGGGGGGCGG AGG (reversed) Intergenic
No off target data available for this crispr