ID: 1191101686

View in Genome Browser
Species Human (GRCh38)
Location X:56736356-56736378
Sequence GCAGGAGAATTGCTTGACCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191101686_1191101697 26 Left 1191101686 X:56736356-56736378 CCGGGGTCAAGCAATTCTCCTGC No data
Right 1191101697 X:56736405-56736427 CCGGTGCCCGCCACCATGCCCGG No data
1191101686_1191101688 -2 Left 1191101686 X:56736356-56736378 CCGGGGTCAAGCAATTCTCCTGC No data
Right 1191101688 X:56736377-56736399 GCCGCAGCCTCCCAAACAGCTGG No data
1191101686_1191101690 -1 Left 1191101686 X:56736356-56736378 CCGGGGTCAAGCAATTCTCCTGC No data
Right 1191101690 X:56736378-56736400 CCGCAGCCTCCCAAACAGCTGGG No data
1191101686_1191101692 7 Left 1191101686 X:56736356-56736378 CCGGGGTCAAGCAATTCTCCTGC No data
Right 1191101692 X:56736386-56736408 TCCCAAACAGCTGGGACCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191101686 Original CRISPR GCAGGAGAATTGCTTGACCC CGG (reversed) Intergenic