ID: 1191101688

View in Genome Browser
Species Human (GRCh38)
Location X:56736377-56736399
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191101681_1191101688 5 Left 1191101681 X:56736349-56736371 CCGCCCCCCGGGGTCAAGCAATT No data
Right 1191101688 X:56736377-56736399 GCCGCAGCCTCCCAAACAGCTGG No data
1191101686_1191101688 -2 Left 1191101686 X:56736356-56736378 CCGGGGTCAAGCAATTCTCCTGC No data
Right 1191101688 X:56736377-56736399 GCCGCAGCCTCCCAAACAGCTGG No data
1191101680_1191101688 8 Left 1191101680 X:56736346-56736368 CCTCCGCCCCCCGGGGTCAAGCA No data
Right 1191101688 X:56736377-56736399 GCCGCAGCCTCCCAAACAGCTGG No data
1191101682_1191101688 2 Left 1191101682 X:56736352-56736374 CCCCCCGGGGTCAAGCAATTCTC No data
Right 1191101688 X:56736377-56736399 GCCGCAGCCTCCCAAACAGCTGG No data
1191101683_1191101688 1 Left 1191101683 X:56736353-56736375 CCCCCGGGGTCAAGCAATTCTCC No data
Right 1191101688 X:56736377-56736399 GCCGCAGCCTCCCAAACAGCTGG No data
1191101684_1191101688 0 Left 1191101684 X:56736354-56736376 CCCCGGGGTCAAGCAATTCTCCT No data
Right 1191101688 X:56736377-56736399 GCCGCAGCCTCCCAAACAGCTGG No data
1191101676_1191101688 17 Left 1191101676 X:56736337-56736359 CCACTGCAGCCTCCGCCCCCCGG No data
Right 1191101688 X:56736377-56736399 GCCGCAGCCTCCCAAACAGCTGG No data
1191101675_1191101688 18 Left 1191101675 X:56736336-56736358 CCCACTGCAGCCTCCGCCCCCCG No data
Right 1191101688 X:56736377-56736399 GCCGCAGCCTCCCAAACAGCTGG No data
1191101685_1191101688 -1 Left 1191101685 X:56736355-56736377 CCCGGGGTCAAGCAATTCTCCTG No data
Right 1191101688 X:56736377-56736399 GCCGCAGCCTCCCAAACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191101688 Original CRISPR GCCGCAGCCTCCCAAACAGC TGG Intergenic