ID: 1191101697

View in Genome Browser
Species Human (GRCh38)
Location X:56736405-56736427
Sequence CCGGTGCCCGCCACCATGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191101693_1191101697 -5 Left 1191101693 X:56736387-56736409 CCCAAACAGCTGGGACCACCGGT No data
Right 1191101697 X:56736405-56736427 CCGGTGCCCGCCACCATGCCCGG No data
1191101689_1191101697 4 Left 1191101689 X:56736378-56736400 CCGCAGCCTCCCAAACAGCTGGG No data
Right 1191101697 X:56736405-56736427 CCGGTGCCCGCCACCATGCCCGG No data
1191101686_1191101697 26 Left 1191101686 X:56736356-56736378 CCGGGGTCAAGCAATTCTCCTGC No data
Right 1191101697 X:56736405-56736427 CCGGTGCCCGCCACCATGCCCGG No data
1191101691_1191101697 -2 Left 1191101691 X:56736384-56736406 CCTCCCAAACAGCTGGGACCACC No data
Right 1191101697 X:56736405-56736427 CCGGTGCCCGCCACCATGCCCGG No data
1191101685_1191101697 27 Left 1191101685 X:56736355-56736377 CCCGGGGTCAAGCAATTCTCCTG No data
Right 1191101697 X:56736405-56736427 CCGGTGCCCGCCACCATGCCCGG No data
1191101687_1191101697 8 Left 1191101687 X:56736374-56736396 CCTGCCGCAGCCTCCCAAACAGC No data
Right 1191101697 X:56736405-56736427 CCGGTGCCCGCCACCATGCCCGG No data
1191101684_1191101697 28 Left 1191101684 X:56736354-56736376 CCCCGGGGTCAAGCAATTCTCCT No data
Right 1191101697 X:56736405-56736427 CCGGTGCCCGCCACCATGCCCGG No data
1191101683_1191101697 29 Left 1191101683 X:56736353-56736375 CCCCCGGGGTCAAGCAATTCTCC No data
Right 1191101697 X:56736405-56736427 CCGGTGCCCGCCACCATGCCCGG No data
1191101682_1191101697 30 Left 1191101682 X:56736352-56736374 CCCCCCGGGGTCAAGCAATTCTC No data
Right 1191101697 X:56736405-56736427 CCGGTGCCCGCCACCATGCCCGG No data
1191101694_1191101697 -6 Left 1191101694 X:56736388-56736410 CCAAACAGCTGGGACCACCGGTG No data
Right 1191101697 X:56736405-56736427 CCGGTGCCCGCCACCATGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191101697 Original CRISPR CCGGTGCCCGCCACCATGCC CGG Intergenic