ID: 1191103503

View in Genome Browser
Species Human (GRCh38)
Location X:56758355-56758377
Sequence GTGCAGATGCCTGTTGGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191103503_1191103513 29 Left 1191103503 X:56758355-56758377 CCAGGTCCAACAGGCATCTGCAC No data
Right 1191103513 X:56758407-56758429 GAGAAAGGCATCTGTCGGGATGG No data
1191103503_1191103506 4 Left 1191103503 X:56758355-56758377 CCAGGTCCAACAGGCATCTGCAC No data
Right 1191103506 X:56758382-56758404 TTGACCCATCCAGCAGAACAGGG No data
1191103503_1191103510 14 Left 1191103503 X:56758355-56758377 CCAGGTCCAACAGGCATCTGCAC No data
Right 1191103510 X:56758392-56758414 CAGCAGAACAGGGTCGAGAAAGG No data
1191103503_1191103514 30 Left 1191103503 X:56758355-56758377 CCAGGTCCAACAGGCATCTGCAC No data
Right 1191103514 X:56758408-56758430 AGAAAGGCATCTGTCGGGATGGG No data
1191103503_1191103512 25 Left 1191103503 X:56758355-56758377 CCAGGTCCAACAGGCATCTGCAC No data
Right 1191103512 X:56758403-56758425 GGTCGAGAAAGGCATCTGTCGGG No data
1191103503_1191103505 3 Left 1191103503 X:56758355-56758377 CCAGGTCCAACAGGCATCTGCAC No data
Right 1191103505 X:56758381-56758403 GTTGACCCATCCAGCAGAACAGG No data
1191103503_1191103511 24 Left 1191103503 X:56758355-56758377 CCAGGTCCAACAGGCATCTGCAC No data
Right 1191103511 X:56758402-56758424 GGGTCGAGAAAGGCATCTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191103503 Original CRISPR GTGCAGATGCCTGTTGGACC TGG (reversed) Intergenic
No off target data available for this crispr