ID: 1191103504

View in Genome Browser
Species Human (GRCh38)
Location X:56758361-56758383
Sequence AACAATGTGCAGATGCCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191103504_1191103512 19 Left 1191103504 X:56758361-56758383 CCAACAGGCATCTGCACATTGTT No data
Right 1191103512 X:56758403-56758425 GGTCGAGAAAGGCATCTGTCGGG No data
1191103504_1191103506 -2 Left 1191103504 X:56758361-56758383 CCAACAGGCATCTGCACATTGTT No data
Right 1191103506 X:56758382-56758404 TTGACCCATCCAGCAGAACAGGG No data
1191103504_1191103510 8 Left 1191103504 X:56758361-56758383 CCAACAGGCATCTGCACATTGTT No data
Right 1191103510 X:56758392-56758414 CAGCAGAACAGGGTCGAGAAAGG No data
1191103504_1191103514 24 Left 1191103504 X:56758361-56758383 CCAACAGGCATCTGCACATTGTT No data
Right 1191103514 X:56758408-56758430 AGAAAGGCATCTGTCGGGATGGG No data
1191103504_1191103505 -3 Left 1191103504 X:56758361-56758383 CCAACAGGCATCTGCACATTGTT No data
Right 1191103505 X:56758381-56758403 GTTGACCCATCCAGCAGAACAGG No data
1191103504_1191103516 29 Left 1191103504 X:56758361-56758383 CCAACAGGCATCTGCACATTGTT No data
Right 1191103516 X:56758413-56758435 GGCATCTGTCGGGATGGGGCAGG No data
1191103504_1191103513 23 Left 1191103504 X:56758361-56758383 CCAACAGGCATCTGCACATTGTT No data
Right 1191103513 X:56758407-56758429 GAGAAAGGCATCTGTCGGGATGG No data
1191103504_1191103511 18 Left 1191103504 X:56758361-56758383 CCAACAGGCATCTGCACATTGTT No data
Right 1191103511 X:56758402-56758424 GGGTCGAGAAAGGCATCTGTCGG No data
1191103504_1191103515 25 Left 1191103504 X:56758361-56758383 CCAACAGGCATCTGCACATTGTT No data
Right 1191103515 X:56758409-56758431 GAAAGGCATCTGTCGGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191103504 Original CRISPR AACAATGTGCAGATGCCTGT TGG (reversed) Intergenic
No off target data available for this crispr