ID: 1191103507

View in Genome Browser
Species Human (GRCh38)
Location X:56758386-56758408
Sequence TCGACCCTGTTCTGCTGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191103507_1191103513 -2 Left 1191103507 X:56758386-56758408 CCCATCCAGCAGAACAGGGTCGA No data
Right 1191103513 X:56758407-56758429 GAGAAAGGCATCTGTCGGGATGG No data
1191103507_1191103512 -6 Left 1191103507 X:56758386-56758408 CCCATCCAGCAGAACAGGGTCGA No data
Right 1191103512 X:56758403-56758425 GGTCGAGAAAGGCATCTGTCGGG No data
1191103507_1191103516 4 Left 1191103507 X:56758386-56758408 CCCATCCAGCAGAACAGGGTCGA No data
Right 1191103516 X:56758413-56758435 GGCATCTGTCGGGATGGGGCAGG No data
1191103507_1191103511 -7 Left 1191103507 X:56758386-56758408 CCCATCCAGCAGAACAGGGTCGA No data
Right 1191103511 X:56758402-56758424 GGGTCGAGAAAGGCATCTGTCGG No data
1191103507_1191103514 -1 Left 1191103507 X:56758386-56758408 CCCATCCAGCAGAACAGGGTCGA No data
Right 1191103514 X:56758408-56758430 AGAAAGGCATCTGTCGGGATGGG No data
1191103507_1191103517 9 Left 1191103507 X:56758386-56758408 CCCATCCAGCAGAACAGGGTCGA No data
Right 1191103517 X:56758418-56758440 CTGTCGGGATGGGGCAGGACAGG No data
1191103507_1191103515 0 Left 1191103507 X:56758386-56758408 CCCATCCAGCAGAACAGGGTCGA No data
Right 1191103515 X:56758409-56758431 GAAAGGCATCTGTCGGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191103507 Original CRISPR TCGACCCTGTTCTGCTGGAT GGG (reversed) Intergenic