ID: 1191103511

View in Genome Browser
Species Human (GRCh38)
Location X:56758402-56758424
Sequence GGGTCGAGAAAGGCATCTGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191103507_1191103511 -7 Left 1191103507 X:56758386-56758408 CCCATCCAGCAGAACAGGGTCGA No data
Right 1191103511 X:56758402-56758424 GGGTCGAGAAAGGCATCTGTCGG No data
1191103508_1191103511 -8 Left 1191103508 X:56758387-56758409 CCATCCAGCAGAACAGGGTCGAG No data
Right 1191103511 X:56758402-56758424 GGGTCGAGAAAGGCATCTGTCGG No data
1191103504_1191103511 18 Left 1191103504 X:56758361-56758383 CCAACAGGCATCTGCACATTGTT No data
Right 1191103511 X:56758402-56758424 GGGTCGAGAAAGGCATCTGTCGG No data
1191103503_1191103511 24 Left 1191103503 X:56758355-56758377 CCAGGTCCAACAGGCATCTGCAC No data
Right 1191103511 X:56758402-56758424 GGGTCGAGAAAGGCATCTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191103511 Original CRISPR GGGTCGAGAAAGGCATCTGT CGG Intergenic
No off target data available for this crispr