ID: 1191103514

View in Genome Browser
Species Human (GRCh38)
Location X:56758408-56758430
Sequence AGAAAGGCATCTGTCGGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191103504_1191103514 24 Left 1191103504 X:56758361-56758383 CCAACAGGCATCTGCACATTGTT No data
Right 1191103514 X:56758408-56758430 AGAAAGGCATCTGTCGGGATGGG No data
1191103508_1191103514 -2 Left 1191103508 X:56758387-56758409 CCATCCAGCAGAACAGGGTCGAG No data
Right 1191103514 X:56758408-56758430 AGAAAGGCATCTGTCGGGATGGG No data
1191103503_1191103514 30 Left 1191103503 X:56758355-56758377 CCAGGTCCAACAGGCATCTGCAC No data
Right 1191103514 X:56758408-56758430 AGAAAGGCATCTGTCGGGATGGG No data
1191103509_1191103514 -6 Left 1191103509 X:56758391-56758413 CCAGCAGAACAGGGTCGAGAAAG No data
Right 1191103514 X:56758408-56758430 AGAAAGGCATCTGTCGGGATGGG No data
1191103507_1191103514 -1 Left 1191103507 X:56758386-56758408 CCCATCCAGCAGAACAGGGTCGA No data
Right 1191103514 X:56758408-56758430 AGAAAGGCATCTGTCGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191103514 Original CRISPR AGAAAGGCATCTGTCGGGAT GGG Intergenic
No off target data available for this crispr