ID: 1191103516

View in Genome Browser
Species Human (GRCh38)
Location X:56758413-56758435
Sequence GGCATCTGTCGGGATGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191103507_1191103516 4 Left 1191103507 X:56758386-56758408 CCCATCCAGCAGAACAGGGTCGA No data
Right 1191103516 X:56758413-56758435 GGCATCTGTCGGGATGGGGCAGG No data
1191103504_1191103516 29 Left 1191103504 X:56758361-56758383 CCAACAGGCATCTGCACATTGTT No data
Right 1191103516 X:56758413-56758435 GGCATCTGTCGGGATGGGGCAGG No data
1191103508_1191103516 3 Left 1191103508 X:56758387-56758409 CCATCCAGCAGAACAGGGTCGAG No data
Right 1191103516 X:56758413-56758435 GGCATCTGTCGGGATGGGGCAGG No data
1191103509_1191103516 -1 Left 1191103509 X:56758391-56758413 CCAGCAGAACAGGGTCGAGAAAG No data
Right 1191103516 X:56758413-56758435 GGCATCTGTCGGGATGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191103516 Original CRISPR GGCATCTGTCGGGATGGGGC AGG Intergenic
No off target data available for this crispr