ID: 1191103517

View in Genome Browser
Species Human (GRCh38)
Location X:56758418-56758440
Sequence CTGTCGGGATGGGGCAGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191103507_1191103517 9 Left 1191103507 X:56758386-56758408 CCCATCCAGCAGAACAGGGTCGA No data
Right 1191103517 X:56758418-56758440 CTGTCGGGATGGGGCAGGACAGG No data
1191103509_1191103517 4 Left 1191103509 X:56758391-56758413 CCAGCAGAACAGGGTCGAGAAAG No data
Right 1191103517 X:56758418-56758440 CTGTCGGGATGGGGCAGGACAGG No data
1191103508_1191103517 8 Left 1191103508 X:56758387-56758409 CCATCCAGCAGAACAGGGTCGAG No data
Right 1191103517 X:56758418-56758440 CTGTCGGGATGGGGCAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191103517 Original CRISPR CTGTCGGGATGGGGCAGGAC AGG Intergenic
No off target data available for this crispr