ID: 1191104383

View in Genome Browser
Species Human (GRCh38)
Location X:56763585-56763607
Sequence CTATGATCCTAGTCCTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191104374_1191104383 16 Left 1191104374 X:56763546-56763568 CCAGCTGGGTGACCAGCACCTTG No data
Right 1191104383 X:56763585-56763607 CTATGATCCTAGTCCTCCTGTGG No data
1191104379_1191104383 -2 Left 1191104379 X:56763564-56763586 CCTTGTCCTGGGGCAGTAGCCCT No data
Right 1191104383 X:56763585-56763607 CTATGATCCTAGTCCTCCTGTGG No data
1191104378_1191104383 4 Left 1191104378 X:56763558-56763580 CCAGCACCTTGTCCTGGGGCAGT No data
Right 1191104383 X:56763585-56763607 CTATGATCCTAGTCCTCCTGTGG No data
1191104380_1191104383 -8 Left 1191104380 X:56763570-56763592 CCTGGGGCAGTAGCCCTATGATC No data
Right 1191104383 X:56763585-56763607 CTATGATCCTAGTCCTCCTGTGG No data
1191104373_1191104383 27 Left 1191104373 X:56763535-56763557 CCTTGTGTAAGCCAGCTGGGTGA No data
Right 1191104383 X:56763585-56763607 CTATGATCCTAGTCCTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191104383 Original CRISPR CTATGATCCTAGTCCTCCTG TGG Intergenic
No off target data available for this crispr