ID: 1191106025

View in Genome Browser
Species Human (GRCh38)
Location X:56772848-56772870
Sequence CTATGATCCCAGTCCTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191106021_1191106025 -2 Left 1191106021 X:56772827-56772849 CCTTGTCCTGGGGCGGCAGCCCT No data
Right 1191106025 X:56772848-56772870 CTATGATCCCAGTCCTCCTGTGG No data
1191106015_1191106025 16 Left 1191106015 X:56772809-56772831 CCAGCTGGGTGGCCAGCGCCTTG No data
Right 1191106025 X:56772848-56772870 CTATGATCCCAGTCCTCCTGTGG No data
1191106022_1191106025 -8 Left 1191106022 X:56772833-56772855 CCTGGGGCGGCAGCCCTATGATC No data
Right 1191106025 X:56772848-56772870 CTATGATCCCAGTCCTCCTGTGG No data
1191106020_1191106025 4 Left 1191106020 X:56772821-56772843 CCAGCGCCTTGTCCTGGGGCGGC No data
Right 1191106025 X:56772848-56772870 CTATGATCCCAGTCCTCCTGTGG No data
1191106013_1191106025 27 Left 1191106013 X:56772798-56772820 CCTTGTGTAAGCCAGCTGGGTGG No data
Right 1191106025 X:56772848-56772870 CTATGATCCCAGTCCTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191106025 Original CRISPR CTATGATCCCAGTCCTCCTG TGG Intergenic
No off target data available for this crispr