ID: 1191107018

View in Genome Browser
Species Human (GRCh38)
Location X:56778250-56778272
Sequence CTATGATCCCAGTCCTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191107013_1191107018 4 Left 1191107013 X:56778223-56778245 CCAGCGCCTTGTCCTGGGGCGGC No data
Right 1191107018 X:56778250-56778272 CTATGATCCCAGTCCTCCTGTGG No data
1191107014_1191107018 -2 Left 1191107014 X:56778229-56778251 CCTTGTCCTGGGGCGGCAGCCCT No data
Right 1191107018 X:56778250-56778272 CTATGATCCCAGTCCTCCTGTGG No data
1191107015_1191107018 -8 Left 1191107015 X:56778235-56778257 CCTGGGGCGGCAGCCCTATGATC No data
Right 1191107018 X:56778250-56778272 CTATGATCCCAGTCCTCCTGTGG No data
1191107006_1191107018 27 Left 1191107006 X:56778200-56778222 CCTTGTGTAAGCCAGCTGGGTGG No data
Right 1191107018 X:56778250-56778272 CTATGATCCCAGTCCTCCTGTGG No data
1191107008_1191107018 16 Left 1191107008 X:56778211-56778233 CCAGCTGGGTGGCCAGCGCCTTG No data
Right 1191107018 X:56778250-56778272 CTATGATCCCAGTCCTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191107018 Original CRISPR CTATGATCCCAGTCCTCCTG TGG Intergenic
No off target data available for this crispr